Absence of JH2 domain mutation of the tyrosine kinase JAK2 in renal cell carcinomas

To the Editor

Signaling pathways initiated by a variety of cytokines and growth factors are essential for cell differentiation, growth and survival. Their dysregulation can contribute to human malignancies. Janus kinases (JAK), which are cytoplasmic tyrosine kinases, play a crucial role in signaling transduction cascades triggered by cytokines whose cognate receptors lack intrinsic tyrosine kinase activity. The JAK family of kinases comprises four known mammalian members, i.e., TYK2, JAK1, JAK2 and JAK3, which associate with the intracellular domains of a large number of cytokine and growth factor receptors. Receptor dimerization after ligand binding leads to activation of JAKs and the subsequent phosphorylation of receptor tyrosine sites that provide docking sites for various SH2-containing signaling molecules, including signal transducer and activator of transcription (STAT). Thus, JAKs constitute important links between cytokine receptors and downstream molecules in signaling pathways.

All members of the JAK family have very similar structures. Each member possesses seven highly conserved domains (JHl–JH7). The JAK C-terminal region consists of tandem kinase and kinase-like (pseudokinase) modules, termed JH1 and JH2, respectively. The JH1 domain contains the typical conserved residues identified in tyrosine specific kinases. Phosphorylation of JH1 is essential for full kinase activity. The JH2 domain appears to have a complex regulatory function on the JH1 catalytic domain. The remaining regions (JH3–JH7) of JAKs may be essential for interacting with their cognate cellular receptors and for coordinating JAK functions.

The JAK2 gene (mapped to 9p24) contains 23 exons encoding an 1132-amino acid protein. An acquired JAK2 gene mutation (V617F) has been recently associated with myeloproliferative disorders [1]. The JAK2 V617F mutation, which causes the substitution of phenylalanine for valine at codon 617 in the JH2 domain, predicts to disrupt the auto-inhibition of the JH1 catalytic domain by the JH2 domain. This gain-of-function mutation is detectable in the majority of patients with polycythemia vera and in many with essential thrombocythemia or idiopathic myelofibrosis [2]. More recently, several other JAK2 mutations, including K539L (a replacement of lysine at position 539 with leucine), F537-K539delinsL (a replacement of phenylalanine at position 537 through lysine at position 539 by a single leucine), H538QK539L (a substitution of glutamine for histidine at position 538 and leucine for lysine at position 539), N542-E543del (a deletion of asparagine at position 542 and glutamic acid at position 543) and L611S (a substitute of serine for leucine at position 611), have also been detected in V617F-negative patients with myeloproliferative disorders [3], [4]. These mutations are also located in the JH2 pseudokinase domain of JAK2 and all result in a constitutive tyrosine phosphorylation activity of this tyrosine kinase.

Clear cell renal cell cancer (RCC) is the most frequent renal cancer subtype that derives from proximal renal tubular cells. Proximal tubular cells of the kidney produce erythropoietin (Epo), a cytokine that stimulates the proliferation of hemopoietic progenitors. Polycythemia vera due to elevated erythropoetin levels is a well known paraneoplastic syndrome in RCC patients. JAK2 is directly linked to erythropoietin receptor (EpoR), therefore mediating EpoR signaling. It is known that mutational activation of JAK2 induces Epo hypersensitivity. An increased expression of both Epo and EpoR at the levels of transcript and/or protein has been described in human primary RCC and in established renal cancer cell lines, indicating the presence of a constitutively activated EpoR-JAK2 signaling in RCC. Previous experiments have shown that activation of EpoR can stimulate proliferation of renal carcinoma cells. These lead to the speculation that aberrant EpoR-JAK2 signaling activation in RCC may be induced by JAK2 mutation. In this context, we employed denaturing gradient gel electrophoresis (DGGE) assay to screen for JAK2 gene mutations in primary clear cell RCCs obtained from 35 patients who underwent partial or radical nephrectomy between 1993 and 2003 at the University Hospital of Zurich, Switzerland. This study obtained approval from local ethics committee and patients gave consent for tissue collection and analyses. Sixteen tumors were in pT1 or 2 stages, while the remaining 19 ones in pT3 stage. The isolation of DNA was conducted as described previously [5]. DGGE-based mutation analysis was performed to screen for mutation within exons 10–16 of JAK2 gene, which encode the JH2 regulatory domain. These exons and their exon-intron junctions were PCR-amplified from tumor DNA using primers given in Table I. PCR amplification and DGGE were carried out as described elsewhere [5]. Samples showing aberrant bands were sequenced using ABI PRISM 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA). However, no mutation in the JH2 region of JAK2 gene was detected in these RCC patients.

Table I.  Primers used for DGGE analysis.

Exon	Primer* (5′→3′)	Product size (bp)
10	Forward: TGGAGCAATTCATACTTTCAGTG	323
	Reverse: CAATGTCACATGAATGTAAATCAAGA
11	Forward: TCTTCCTCATTGAATGTATTTTCTT	325
	Reverse: TGAGAGCACATCTTTAAACAGCA
12	Forward: TGCTGAAAGTAGGAGAAAGTGC	339
	Reverse: CTGACACCTAGCTGTGATCCTG
13	Forward: TGAGTTTTGCCAATTTAATTTCTT	381
	Reverse: TTGTTTCCAGGTAAAGATAATTTGT
14	Forward: TTTTGGGGGCTTGAACATAC	330
	Reverse: CCTTTACACCACTGCCCAAG
15	Forward: AAAATAGGCCTGATTATTCAAATG	371
	Reverse: TGTGAAAGAAATATGAAAGTTCAGAGA
16	Forward: AAGGTTGGTGTGGCATTACA	294
	Reverse: GAAAGCTGGAAAATCAATAAGATCA

*a 40-nucleotide CG-clamp was attached to the beginning of the forward primer of each primer pairs. To reach optimal DGGE conditions, the primers were modified by addition of a stretch of G/C or A/T nucleotides (two to ten) to the primer beginning, which was determined by computer simulation of DNA melting using the software WinMelt Version 2 (BioRad, Hercules, CA).

Accumulating evidence suggests that JAK kinases contribute to the pathogenesis of various human neoplastic diseases. In addition to the well-described role of JAK2 in myeloproliferative disorders, direct downstream molecules of JAK kinases, i.e., STATs, are constitutively activated in a variety of hematological malignancies and solid tumors. JAK activities are generally required for the activation of STATs. However, a constitutive activation of JAKs could result from either JAK gain-of-function mutation or an increased activity of their upstream molecules. Our data demonstrate absence of JH2 domain mutation of JAK2 in human clear cell RCC, suggesting that the activation of EpoR-JAK-STAT signaling may not be related to JAK2 mutation in RCC.

Acknowledgements

This work was supported by the Cancer League of Canton of Zurich, Switzerland.