Co-infections of chickens with avian influenza virus H9N2 and Moroccan Italy 02 infectious bronchitis virus: effect on pathogenesis and protection conferred by different vaccination programmes

ABSTRACT

Since the emergence of low pathogenic avian influenza (LPAI) H9N2 viruses in Morocco in 2016, severe respiratory problems have been encountered in the field. Infectious bronchitis virus (IBV) is often detected together with H9N2, suggesting disease exacerbation in cases of co-infections. This hypothesis was therefore tested and confirmed in laboratory conditions using specific-pathogen-free chickens. Most common field vaccine programmes were then tested to compare their efficacies against these two co-infecting agents. IBV γCoV/chicken/Morocco/I38/2014 (Mor-IT02) and LPAI virus A/chicken/Morocco/SF1/2016 (Mor-H9N2) were thus inoculated to commercial chickens. We showed that vaccination with two heterologous IBV vaccines (H120 at day one and 4/91 at day 14 of age) reduced the severity of clinical signs as well as macroscopic lesions after simultaneous experimental challenge. In addition, LPAI H9N2 vaccination was more efficient at day 7 than at day 1 in limiting disease post simultaneous challenge.

RESEARCH HIGHLIGHTS

• Simultaneous challenge with IBV and AIV H9N2 induced higher pathogenicity in SPF birds than inoculation with IBV or AIV H9N2 alone.

• Recommended vaccination programme in commercial broilers to counter Mor-IT02 IBV and LPAIV H9N2 simultaneous infections: IB live vaccine H120 (d1), AIV H9N2 inactivated vaccine (d7), IB live vaccine 4-91 (d14).

KEYWORDS:

• Morocco
• infectious bronchitis virus
• avian influenza virus H9N2
• specific pathogen free chickens
• commercial broilers
• vaccination

Introduction

Avian respiratory viruses, including infectious bronchitis virus (IBV) and avian influenza virus (AIV), are among the primary causes of morbidity and mortality in the poultry industry worldwide and have been identified as the most economically important viral agents of acute and highly contagious diseases (Haghighat-Jahromi et al., 2008). IBV is a coronavirus, an enveloped positive strand RNA virus with a genome of 27 kb. It belongs to the family Coronaviridae, subfamily Coronavirinae, and to the genus Gammacoronavirus (Jackwood, 2012). AIVs are type A orthomyxoviruses and are classified as low pathogenic or highly pathogenic viruses based on their virulence in chickens or according to the presence of multiple basic amino acids at the cleavage site of the haemagglutinin (HA) precursor protein (Swayne et al., 2013). These pathogens are of major significance and have a large economic impact because they are able to induce disease independently or in association with other avian pathogens (Roussan et al., 2008).

AIV H9N2 is classified as a low pathogenic virus. However, high mortality has been reported in broiler farms in Morocco and in many other countries in Africa and Asia (Nili & Asasi, 2002, 2003; Al-Garib et al., 2016; El Houadfi et al., 2016; Ismail et al., 2018). In Morocco, the low pathogenic avian influenza virus (LPAIV) subtype H9N2 was first identified in poultry in January 2016 and spread very quickly throughout the country (El Houadfi et al., 2016). Phylogenetic analyses showed that Moroccan viruses belonged to the G1 H9N2 lineage and likely originated from the Middle East (El Houadfi et al., 2016).

Co-infections of poultry with multiple agents are common and have resulted in more severe clinical signs when compared to single agent infections (Bano et al., 2003; Stipkovits et al., 2012). Likewise, co-infections of LPAIV H9N2 with other respiratory pathogens, particularly with IBV, Mycoplasma gallisepticum, Staphylococcus aureus, Avibacterium paragallinarum, Escherichia coli, Ornithobacterium rhinotracheale and/or immunosuppressive agents can exacerbate LPAIV H9N2 infections and result in severe clinical disease with different rates of mortality (Nili & Asasi, 2002; Kishida et al., 2004; Perk et al., 2006). Previous studies have demonstrated longer H9N2 virus shedding, more severe clinical signs and higher mortality rates caused by a co-infection with LPAIV H9N2 and IBV, either as a vaccine or as a wild-type virus (Seifi et al., 2012; Hassan et al., 2017; Ismail et al., 2018).

The aim of this study was to test the hypothesis that IBV exacerbates the pathogenic effect of LPAIV H9N2 in vivo and to determine the appropriate vaccination protocol allowing for good protection in the case of simultaneous challenge with IBV + H9N2. Firstly, we compared the pathogenicity of γCoV/chicken/Morocco/I38/2014 (Mor-IT02) and A/chicken/Morocco/SF1/2016(H9N2) (Mor-H9N2) alone and in combination in specific-pathogen-free (SPF) chickens. We then evaluated the protection conferred by different vaccination protocols against simultaneous co-infection with Mor-IT02 and Mor-H9N2.

Materials and methods

Viruses and vaccines

In order to stay as close as possible to field conditions, we selected two recently isolated Moroccan viruses for the co-infection experiments, representative of the viruses currently circulating in the country: γCoV/chicken/Morocco/I38/2014, referred to as Mor-It02 (accession number for its S1 gene sequence: KJ701020) (Fellahi et al., 2015) and A/chicken/Morocco/SF1/2016(H9N2), a LPAIV H9N2 referred to as Mor-H9N2 (accession number for its HA gene sequence: LT598497) (El Houadfi et al., 2016).

Challenge virus titrations were performed using 10-day-old SPF chicken embryos (CE) inoculated via the allantoic cavity. For IBV, the CEs were examined daily to check the viability of the embryos up to 6 days post inoculation. After placing the eggs at 4°C for 24 h, the embryos were examined for characteristic IBV lesions (curling and dwarfing). For AIV, after 72 h of incubation, surviving CEs were chilled and allantoic fluid collected and tested for positive haemagglutination with chicken erythrocytes.

The viral titres of the two viruses (IBV and AIV) were calculated following the method described by Reed and Muench (1938) and expressed as the 50% egg infective dose 50 per ml (EID₅₀/ml).

IB commercial live attenuated vaccines used in this study were Mass H120 (Bioral H120, batch number: L418386, 3.7–5.0 log₁₀ EID₅₀) and 4/91 (Nobilis IB 4-91, batch number: A188CJ01, 3.6 log₁₀ EID₅₀). Vaccines were delivered in 0.2 ml/dose via the ocular and nasal routes as recommended by the vaccines' manufacturers. Commercial inactivated vaccine against avian influenza H9N2 (G1 Middle Eastern strain) was used with 0.3 ml/dose of vaccine administered by subcutaneous injection as recommended by the vaccine manufacturer.

Experimental design

In all experiments, management procedures for all groups were identical. Experiments were conducted in accordance with European and French legislations on Laboratory Animal Care and Use (French Decree 2001-464 and European Directive CEE86/609) and animal protocols were approved by the Ethics Committee “Sciences et santé animale”, committee number 115.

Experiment 1: pathogenicity study in SPF chicks

Twenty-eight SPF chicks were divided into four groups, individually identified and housed in negative pressure High Efficiency Particulate Air isolators (Allentown, NJ, USA and Noroit, Bouaye, France) at the Joined Research Unit Host–Pathogen Interactions (1225) at the National Veterinary School of Toulouse (France). The birds were housed in animal biosafety level 2 facilities and had free access to food and water. They were infected at 21 days of age with a total volume of 0.2 ml by the oculo-nasal route. Doses of 10³ EID₅₀ of IBV and 10⁶ EID₅₀ of AIV were administered. In this pilot experiment, the birds were not vaccinated. The four groups were as follows: G_IB, infected with Mor-IT 02 virus (n = 5 birds); G_AI, infected with Mor-H9N2 virus (n = 9); G_IB/AI, infected simultaneously with Mor-IT02 and Mor-H9N2 viruses (n = 9); G_NI, not infected (n = 5).

Experiment 2: study comparing vaccination regimens in commercial broilers

Eighty commercial day-old broiler chicks from a Moroccan commercial hatchery were used to perform two experiments, each with 40 chicks, and each divided into four groups (n = 10 birds per group) with two groups (G_H120/4-91/H9 and G_NEG-CON groups) repeated in both experiments due to laboratory space constraints (six groups could not have been separated in a single experiment). The chicks were housed at the Avian Pathology Unit of the Agricultural and Veterinary Institute (Rabat, Morocco). The experimental protocol of the two combined experiments (experiments 2a and 2b) is presented in Table 1.

Table 1. Experimental design.

	Days of age	GH120/4-91/H9 (n = 20)	GH120/H120/H9 (n = 10)	GH120/H9 (n = 10)	GH120/4-91/H9D1 (n = 10)	GPOS-CON (n = 10)	GNEG-CON (n = 20)
Vaccination	D1	H120	H120	H120	H120 and H9	–	–
	D7	H9	H9	H9	–	–	–
	D14	4-91	H120	–	4-91	–	–
Challenge	D28	Co-infection IBV and AIV	Co-infection IBV and AIV	Co-infection IBV and AIV	Co-infection IBV and AIV	Co-infection IBV and AIV	No infection

Note: H120 and 4-91: IB vaccines; H9: H9N2 AI vaccine; –: no vaccination.

In both experiments 2a and 2b, the chickens were individually identified and then co-infected simultaneously at 28 days of age by the oculonasal route with 10³ EID₅₀/0.2 ml of IBV Mor-IT02 and 10⁶EID₅₀/0.2 ml of AIV Mor-H9N2.

Clinical signs

In all experiments, daily clinical observations were performed by the same investigator for consistency reasons. The clinical signs included respiratory signs such as dyspnoea, rales, nasal discharge and respiratory distress. Strict measures were applied to avoid cross contamination between different groups. The clinical signs were recorded until 10 days post challenge (dpc).

Macroscopic lesions

In SPF chicks (experiment 1), at 5 dpc, three birds from each group were euthanized and macroscopic lesions observed in all organs were recorded. The remaining birds were euthanized at day 10pc. All gross lesions were recorded. In commercial broilers (experiment 2), post mortem examination at 5 dpc was performed on five birds from each group. The remaining birds were humanely sacrificed at 9 and 10 dpc in experiments 2a and 2b, respectively.

Microscopic lesions

Trachea and lung samples from SPF birds (experiment 1) were taken from each sacrificed bird at 5 dpc. Samples were fixed in 10% formalin for the determination of microscopic lesions. After fixation, tissues were routinely processed in paraffin blocks, sectioned at 4 µm and stained with haematoxylin and eosin for microscopic examination.

Serology

Blood was collected when the chickens were 1, 14, 28, and 37–38 days of age: at arrival, before vaccine boost, pre-challenge, and 10 dpc. IBV and AIV antibody titres of commercial broilers were measured using Synbiotics ProFlock ELISA kits (Zoetis, Kansas City, MO) following the manufacturer instructions.

Virus shedding measured by real-time RT–PCR

Oropharyngeal swabs were collected at 3, 5 and 7 dpc in experiment 1 (SPF birds) and at 3, 5, 7 and 9 dpc in experiment 2 (commercial broilers) to assess virus shedding. The swabs were stored in 1 ml of PBS containing 100 U/ml penicillin and 100 µg/ml streptomycin (Invitrogen) and kept at −80°C until further use.

IBV and AIV viral RNA were extracted using the Macherey-Nagel viral RNA extraction kit (Düren, Germany) following the instructions of the manufacturer. The extracted RNA was subjected to real-time RT–PCR in two steps. First, a reverse transcription was carried out using the Revertaid kit (Thermo Fisher Scientific) on an Applied Biosystems thermocycler (Foster City, USA). Primers used for IBV detection targeted the 5′ untranslated region of IBV and were designed by Callison et al. (2006): IBV5′GU391, 5′ GCTTTTGAGCCTAGCGTT 3′; IBV5′GL533, 5′ GCCATGTTGTCACTGTCTATTG 3′; and IBV5′G Taqman®, 5′ FAM-CACCACCAGAACCTGTCACCTC-BHQ1 3′. For AIV detection, the primers and probe targeted the matrix gene and were described by Spackman et al. (2002): AIV-M-P1, 5′ AGATGAGTCTTCTAACCGAGGTCG 3′; AIV-M-P2, 5′ TGCAAAAACATCTTCAAGTCTCTG 3′; and AIV-M-Probe, 5′ FAM-TCAGGCCCCCTCAAAGCCGA-TAMRA 3′. PCRs were carried out using the iTaq Universal Probes Supermix kit (BioRad, Foster City, USA). The reaction mix consisted of 5 µl of 2x itaq mix, 1.75 µl nuclease free water, 0.5 µl of each primer (10 µM), 0.25 µl of probe (10 µM), and 2 µl cDNA with the following programme: initial denaturation: 94°C for 2 min, followed by 40 cycles of denaturation at 94°C for 10s and hybridization/elongation for 30sec at 60°C. A LightCycler 480 (Roche, Penzberg, Germany) was used.

Results

Experiment 1: Increased pathogenicity with IBV-H9N2 virus co-infection as compared to single infections in SPF chickens

No mortality was reported in any group. No clinical signs, lesions or virus were detected in the negative control group. As early as 24 h post challenge (hpc), birds infected with IBV and AIV separately (G_IB and G_AI) or co-infected simultaneously with both viruses (G_IB/AI) started to show clinical signs. The peak was observed at 5 dpc. The co-infected group (G_IB/AI) showed significantly more respiratory signs than its counterparts. The birds showed intense depression and nasal discharge with some birds having very severe respiratory signs (Table 2). Similarly, birds in the G_IB/AI group showed the most severe macroscopic lesions at necropsy 5 dpc, ranging from tracheal congestion and air sac thickening to fibrinous sinusitis in one bird out of three. Histopathology investigation revealed a constant subacute tracheitis in all infected groups. However, lesions were again more intense in the G_IB/AI group (Table 2). Interestingly, virus shedding was similar in the mono- and co-infected groups, with 7 days of shedding for both viruses, and comparable Ct values by real-time PCR (Table 2).

Table 2. Pathogenicity comparison after mono- and co-infections with Mor-IT02 and Mor-H9N2 in SPF chickens.

Groups	Respiratory signs	Histo^a	Macroscopic lesions D5	Shedding duration/IBV^b	Shedding duration/AIV^b
GIB	+	+	+	7	0
GAI	+	+	+	0	7
GIB/AI	+ +	+ +	+ +	7	7
GNI	–	–	–	0	0

Note: –: none; +: mild signs or lesions; ++: severe signs or lesions; RS: respiratory signs; Histo: histopathological lesions; D5: 5 dpc.

^a Microscopic lesions were observed in the trachea, such as loss of cilia (on the epithelium). The lamina propria was infiltrated by heterophilic inflammatory cells, and mononuclear cells (lymphocytes, plasmocytes, macrophages) were recorded. In the lung, histopathological investigations revealed the presence of marked subacute bronchitis with hyperaemia, oedema, heterophils and mononuclear cell infiltration in the lamina propria in the G_IB/AI group. Less pronounced lesions were observed in the lungs of birds in the G_IB and G_AI groups. However, a necrotic and suppurative focus in a lung sample of one bird of G_IB group was recorded.

^b Shedding duration in days.

In summary, the pilot experiment confirmed that IBV and AIV co-infection exacerbates the clinical disease. Indeed, co-infection with Mor-IT02 and Mor-H9N2 viruses led to more severe disease and lesions than mono-infections without higher or longer replication of either of the two viruses in SPF birds.

Experiment 2: Vaccination programmes and IBV-AIV simultaneous challenge: moderate to severe clinical signs except for the G_{H120/4-91/H9D7} birds

Respiratory signs were detected in infected commercial broilers as early as 48 hpc with varying intensity between groups. The clinical signs peaked at 5 dpc. For all groups, respiratory signs ranged from mild respiratory distress to severe rales, most commonly reported in the G_POS-CON group (the unvaccinated co-infected positive control group) and G_{H120/4-91/H9D1} group (vaccinated with two heterologous IB vaccines and AI vaccination at one day of age). In the G_{H120/4-91/H9D1} group, at 5 dpc intense clinical signs were recorded and one chick out of 10 died at 5 dpc (the only mortality in this study). At 9 dpc, 100% of the chicks still showed clinical signs and one chick out of five developed respiratory gasps (Table 3).

Table 3. Comparison of protection conferred by different vaccination programmes against Mor-IT02 and Mor-H9N2 co-infection in commercial broilers.

Groups	Respiratory signs	Macroscopic lesions D5	Shedding duration/IBV^a	Shedding duration/AIV^a
GH120/4-91/H9D7	+	+	5	5
GH120/H120/H9D7	+ +	+ +	9	5
GH120/H9D7	+ +	+ +	9	5
GH120/4-91/H9D1	+ +	+ +	9	9
GPOS-CON	+ ++	+ +	9	9
GNEG-CON	–	–	0	0

Note: –: none; +: mild signs or lesions; ++: severe signs or lesions; +++: very severe signs or lesions; D5: 5 dpc.

^a Shedding duration in days.

In the G_{H120/4-91/H9D7} group, moderate clinical signs were noted with a maximum severity at 5 dpc with four chicks out of 20 with respiratory rales. In addition, at 6 dpc, the chicks started to recover. At 9 dpc, only three out of 10 chickens showed slight respiratory signs (Table 3).

As for the G_{H120/H120/H9D7} group, 100% of the chicks showed respiratory signs as early as 48 hpc and the maximum intensity of clinical signs was noted at 4 and 5 dpc. In this group, chickens showed more severe respiratory signs than in the G_{H120/4-91/H9D7} group, such as the presence of severe rales, respiratory dyspnoea and intense depression. Chickens started to recover at 6 dpc and no mortality was observed. Similarly, moderate respiratory signs were noted as early as 48 hpc in the G_H120/H9 group. At 9 dpc, 100% of the chicks still showed clinical signs (Table 3).

In the G_POS-CON group, the clinical signs observed were severe rales, intense respiratory distress, lacrimation and presence of whitish diarrhoea in five chicks at 3 dpc. In this unvaccinated and co-infected group, the chicks started to recover at 6 dpc as in the other groups, but three out of five chickens still showed marked respiratory distress at 9 dpc. In contrast and as expected, no clinical signs were recorded in the negative control group G_NEG-CON (Table 3).

Vaccination programmes and IBV-AIV simultaneous challenge: macroscopic lesions 5 days post challenge except for the G_{H120/4-91/H9D7} birds

The autopsy performed on day 5 after experimental simultaneous challenge revealed that the lesions were limited to the respiratory tract with variable intensities in the different infected groups (Table 3). The lesions observed were tracheal congestion, airsacculitis, thickening of air sacs, and lung congestion. Fibrin deposit was formed in the trachea and bronchial bifurcation, in abdominal airsacs and sinuses. Different organs such as the liver, kidney, spleen and thymus were congested.

The most severe lesions were observed in the G_POS-CON group with 80% of the chicks showing tracheal congestion and thickening of the air sacs. In addition, a fibrin deposit was observed at the bronchial bifurcation in 40% of examined G_POS-CON chicks. Similar lesions were observed in the G_{H120/4-91/H9D1} group with a case of mortality reported at 5 dpc. The necropsy carried out on the dead chicken revealed the presence of fibrin deposits at the bronchial bifurcation, throughout the trachea and on the air sacs.

In the G_{H120/H120/H9D7} group, 80% of the birds had tracheitis, 80% airsacculitis, and 40% fibrinous sinusitis at 5 dpc. Similar lesions with similar percentages of birds affected were found in the G_H120/H9D7 group. As far as the G_{H120/4-91/H9D7} group was concerned, moderate lesions were observed as compared to the four other infected groups.

As expected, no lesions were observed in the negative control group (Table 3).

Vaccination programmes and IBV-AIV shedding: faster virus clearance for the G_{H120/4-91/H9D7} birds

IBV (Mor-IT02) and AIV (Mor-H9N2) shedding was assessed by real-time PCR on oropharyngeal swabs collected from chickens after infection. No significant difference was observed in IBV titres between the infected groups, but viral shedding was of shorter duration in the G_{H120/4-91/H9D7} group compared to the other groups (clearance by day 7 for G_{H120/4-91/H9D7} versus after day 9 for all other groups). The percentage of chickens shedding IBV differed among groups with 75% of the G_{H120/4-91/H9D7} birds shedding virus at 3 dpc (before a decrease in the number of positive chicks on the later days), as compared to 100% of the chicks in the G_{H120//H120/H9D7}, G_H120/HD79, G_{H120/4-91/H9D1} and G_POS-CON groups (Figure 1A).

Figure 1. Virus shedding in commercial broilers after different vaccine regimens. A. IBV shedding. B. AIV shedding. Groups of birds are indicated on the x axis. The four panels for each virus correspond to the four days for which swabs were tested: 3 dpc (closed black circle shaped symbols), 5 dpc (closed black square shaped symbols), 7 dpc (closed black triangle shaped symbols), and 9 dpc (closed black diamond shaped symbols). Ct: cycle threshold.

As for the Mor-H9N2 virus (AIV), the maximum percentage of positive birds was noted at 3 dpc for all infected groups. Viral clearance was recorded at 7 dpc in all vaccinated groups irrespective of the IBV vaccine programme (G_H120/H120/H9, G_H120/H120/H9 and G_H120/H9), except for 20% of the G_{H120/4-91/H9D1} birds that still shed virus 9 dpc. Similarly, 40% of the G_POS-CON chicks tested positive for AIV at 9 dpc (Figure 1B).

No chicken tested positive in the negative control group (G_NEG-CON) for either virus tested.

Seroconversion after vaccination and after challenge in commercial chickens

All birds had high levels of maternally-derived antibodies against both IBV and AIV at 1 day of age, at 14 days of age antibodies were below the threshold of detection. IBV antibodies were just above the detection threshold at 28 days of age (just before challenge) but most birds were seronegative for AIV at 28 days. All infected birds had seroconverted against both IBV and AIV at 37–38 days (10 dpc, data not shown).

Discussion

Despite its “low pathogenic” qualification, AIV H9N2 causes frequent outbreaks of disease with high mortality and significant economic losses in different poultry production types around the world (Nili & Asasi, 2002, 2003; Swayne et al., 2013; Parvin et al., 2014, 2015; Al-Garib et al., 2016; El Houadfi et al., 2016). In the field, co-infections are frequently reported and might be responsible for the severe clinical signs observed (Nili & Asasi, 2003; Kishida et al., 2004; Perk et al., 2006).

Aouini et al. (2018) evaluated viral interactions in vitro between an IBV live vaccine strain (H120) and LPAIV H9N2 that were simultaneously or sequentially inoculated, and showed an antagonism and interference between them which led to decreased viral growth. Likewise, in the case of super-infection (when AIV and IBV were inoculated with a 1 h interval), the second virus, either AIV or IBV, induced a decrease in the growth of the first inoculated virus (Aouini et al., 2018).

In contrast to these findings, co-infection with respiratory pathogens, such as IBV circulating in the field or live IBV vaccine, was shown to be one of the causes of increased virus pathogenicity and prolonged H9N2 viral shedding (Hassan et al., 2017; Ismail et al., 2018). Live IBV vaccine was indeed shown to provide proteases that increased the pathogenicity of AIV H9N2, due to a trypsin-like serine domain encoded by IBV (Liu et al., 1995; Ng & Liu, 2000). The present study confirmed the hypothesis that IBV exacerbates the pathogenic effects of AIV H9N2 on SPF chickens. Our first experiment indeed suggested a synergistic effect of the two pathogens as was reported in other studies (Karimi-Madab et al., 2010; Seifi et al., 2012; Hassan et al., 2017). Haghighat-Jahromi et al. (2008) and Tavakkoli et al. (2011) reported that H9N2 viral shedding reached higher titres and lasted longer, when birds were vaccinated with a live IBV vaccine (Haghighat-Jahromi et al., 2008; Tavakkoli et al., 2011). The differences observed when using live IBV vaccine versus wild-type virus, and when looking in vitro versus in vivo, are still poorly understood and require further studies. However, most studies (including ours), and more importantly in vivo experiments and field observations, tend to suggest a synergetic effect of the two pathogens. The putative role of vaccination with live vaccines in pathogenesis in cases of co-infections is of great animal health importance and should be investigated.

We also performed this study to understand the role of maternally derived antibodies in the synergy of IBV and AIV. The commercial birds used in the present study (experiment 2) had high levels of maternally-derived antibodies that waned within the first 2 weeks of the bird's life. The combination of H120 and 4/91 IBV vaccines showed not only the best protection against Mor-IT02 infection, as already reported (Belkasmi et al., 2017), but also against Mor-IT02 and Mor-H9N2 simultaneous challenge. The AIV H9N2 vaccination at day 7 rather than day 1 provided much better protection, likely due to lower levels of maternally-derived antibodies at day 7 than at day 1 and/or to a more mature immune system at day 7 than at day 1.

Whether the two viruses, AIV H9N2 and IBV, are synergistic or interfering, should be assessed with different times of infection, with not only simultaneous but also sequential inoculations, likely closer to field situations. In addition, vaccines (both live and inactivated) against each disease should be looked at separately and the age of vaccination should be assessed taking into account the level of maternally-derived antibodies. Clinical signs may indeed be reduced in the field if one makes sure that maternally-derived antibodies do not neutralize the vaccines used.

In conclusion, the results of these studies showed that vaccination with two heterologous IBV vaccines (H120 and 4/91) combined with AIV H9N2 vaccination at day 7 reduced the severity of clinical signs and macroscopic lesions following experimental simultaneous challenge with Mor-IT02 and Mor-H9N2. This vaccination programme could be recommended to poultry farms with a similar epidemiological status as the one described here.

Acknowledgements

The authors would like to thank the Hubert Curien Partnership (PHC) (grant Toubkal/16/25–Campus France 34654NL entitled “Coronavirus aviaries émergents et réémergents au Maroc”) for financial support.

Disclosure statement

No potential conflict of interest was reported by the authors.

ORCID

Mariette F. Ducatez http://orcid.org/0000-0001-9632-5499

Additional information

Funding

This work was supported by Partenariat Hubert Curien TOUBKAL [grant Toubkal/16/25–Campus France 34654NL].