Southwestern Ontario Regional Meeting, 2009/Réunion régionale du sud-ouest de l'Ontario, 2009

Transformation of Sclerotinia sclerotiorum with GFP and RFP gene markers. L. S. BOTELHO, J. C. MACHADO, G. J. BOLAND, R. PEDROZO AND C. S. SIQUEIRA

Federal University of Lavras-Department of Plant Pathology, Lavras – MG, Brazil; and (G.J.B.) School of Environmental Sciences, University of Guelph, 50 Stone Road East, Guelph, ON N1G 2W1, Canada

Sclerotinia sclerotiorum (Lib.) de Bary is an important pathogen of many plants throughout the world, including bean and soybean. The disease ‘white mold’ or ‘stem rot’ causes a reduction in stand, debilitation and death of plants, and can be transmitted by infested or infected seeds. To investigate the dynamics and mechanisms of transmission of this pathogen, the objective of this work was to transform S. sclerotiorum using gene expression markers of type GFP (Green Fluorescent Protein Gene, pSC001) and DsRed (Red Fluorescent Protein Gene, pSC002) that encode proteins that fluoresce when excited at 558 nm and 395 nm, respectively. Previously described transformation protocols were used with some adaptations. Protoplasts were prepared from five-day-old mycelium grown on potato-dextrose-agar (PDA) and transferred to osmotic solution containing NaCl/KCl (0.7 M) with 10 mg of lysing enzyme for each 3 mL of culture, and incubated in shake culture at 75 rpm for 3 h at 28 °C. Putative transformants were selected in hygromycin-containing PDA medium, and later confirmed by observation of fluorescent hyphae using fluorescence microscopy. A total of 10 transformants were obtained using pSC001 and five with pSC002 but there was variability in the intensity of fluorescence among isolates using either plasmid. Some transformants grew as well as the control isolates while others grew more slowly. These transformants are currently being evaluated for integration of plasmids, pathogenicity and fluorescence in vitro and in planta . Characterized transformants will be used to evaluate seed infection and transmission in resistant and susceptible soybean varieties.

Production and carpogenic germination of secondary sclerotia of Sclerotinia sclerotiorum following freezing treatments on primary sclerotia. J. E. COWAN AND G. J. BOLAND

School of Environmental Sciences, University of Guelph, 50 Stone Road East, Guelph, ON N1G 2W1, Canada

Sclerotia of Sclerotinia sclerotiorum (Lib.) de Bary enable it to survive adverse environmental conditions. Several studies have noted these primary sclerotia germinating with sparse mycelial growth to form smaller ‘secondary sclerotia’ nearby; however, formation and carpogenic germination characteristics of these secondary sclerotia have rarely been documented. This study noted conditions for secondary sclerotia formation and subsequent carpogenic germination within laboratory experiments examining the role of freezing temperatures as regulators of carpogenic germination in primary sclerotia of S. sclerotiorum (isolate 274, from bean, Nebraska, US). Sclerotia pre-conditioned for carpogenic germination (at 4 °C) were treated at either − 13 °C or 4 °C for 28 days before incubation on water agar for carpogenic germination. Under these conditions, secondary sclerotia were only produced from frozen sclerotia, which averaged 74% cell damage compared with <1% in unfrozen controls. However, only seven secondary sclerotia were produced from 360 frozen primary sclerotia. Nevertheless, five of the seven secondary sclerotia went from inception to carpogenic germination, without cold-temperature conditioning, within 57–111 days following incubation of the primary sclerotia on water agar. Secondary sclerotia as small as 1 mm diameter were still capable of forming fertile apothecia. These results provide insight into the functional and epidemiological significance of secondary sclerotia of S. sclerotiorum.

Effect of lime sulphur on the control of postharvest brown rot [ Monilinia fructicola ] on Ontario peaches. N. G. GLOVER, L. I. WAINMAN AND D. ERRAMPALLI

Southern Crop Protection and Food Research Centre, Agriculture and Agri-Food Canada, Vineland Station, 4902 Victoria Avenue North, ON L0R 2E0, Canada

Brown rot caused by Monilinia fructicola (Winter) Honey is a primary source of stone fruit crop loss annually. Lime sulphur, a fungicide which has reportedly demonstrated curative ability against apple scab, has also been registered for organic fruit production. The objective of this study was to determine the effect of lime sulphur as a postharvest fungicide in controlling brown rot caused by M. fructicola. Three cultivars of both immature and mature Ontario peaches (Prunus persica (L.) Batsch) were used: ‘Loring’ in 2008 and both ‘Harrow Diamond’ and ‘Redhaven’ in 2009. Each peach was wounded and then inoculated with 15 uL of M. fructicola (1 × 10⁴ conidia mL⁻¹). The fruit were then sprayed with a lime sulphur solution at a concentration of (3.45% a.i. of sulphur mL⁻¹) at 5, 10 or 24 h after inoculation. After five days, disease incidence, disease area, and spore area were recorded. Disease incidence was significantly lower in the fruit treated with lime sulphur. The varying application time of lime sulphur did not cause a significant difference in disease incidence for any cultivar of peach. Mature fruit were more susceptible to infection than the immature fruit. Lime sulphur has a potential to be included in the integrated pest management of brown rot in peaches.

Biological detoxification of mycotoxin deoxynivalenol by soil bacteria. M. R. ISLAM, T. ZHOU, P. H. GOODWIN AND K. P. PAULS. (M.R.I., T.Z.) Food Research Centre, Agriculture and Agri-Food Canada, 93 Stone Road West, Guelph, ON N1G 5C9, Canada; and (M.R.I., P.H.G., K.P.P.) Department of Plant Agriculture, Crop Science Building, University of Guelph, 50 Stone Road East, Guelph, ON N1G 2W1, Canada

Fusarium graminearum Schwabe produces the mycotoxin, deoxynivalenol (DON), in cereals which poses a serious health threat to humans and livestock upon consumption. Due to the limitations of available methods for detoxifying mycotoxins in food and feeds, we screened soil samples to search for micro-organisms capable of transforming DON to de-epoxy DON (deDON), a significantly less toxic metabolite of this mycotoxin. Soil samples collected from various locations in Ontario were inoculated with 100 ppm DON. Biodegradation of DON was analyzed by a Liquid Chromatography-Ultraviolet-Mass spectrometric method (LC-UV-MS). We investigated the effects of five factors: growth substrates, pH, incubation time, temperature and aerobic/anaerobic conditions on biodegradation. Out of 150 soil samples, one sample showed 100% DON to deDON biotransformation on nutrient broth (NB) and mineral salts broth (MSB) medium supplemented with 0.5% bacto-peptone after 3 d of incubation at room temperature and pH 7. This microbial culture showed DON de-epoxydation completely under both aerobic and anaerobic conditions after numerous transfers to fresh MSB medium. To facilitate the isolation of the target bacteria, the culture was treated with different antibiotics and heat. Reduction of the microbial diversity was analyzed using terminal-restriction fragment length polymorphism (T-RFLP) procedure. T-RFLP fingerprints showed a considerable reduction of microbial diversity without negatively affecting the DON degradation ability of the culture. The enriched culture could be a potential source of inocula for feed decontamination. In addition, isolation of the antitoxin gene and expression into a cereal genome would reduce the DON contamination in Fusarium-infested cereals. This is the first report on DON to deDON biotransformation by soil bacteria in aerobic conditions at room temperature.

Classification of Penicillium spp. in apples collected from packinghouses in southern Ontario using PCR-RFLP. I. LOZYNSKA, L . VAN DRIEL AND D. ERRAMPALLI

Southern Crop Protection and Food Research Centre, Agriculture and Agri-Food Canada, Vineland Station, 4902 Victoria Avenue North, ON L0R 2EO, Canada

Blue mold, caused by Penicillium spp., is an important postharvest disease that can lead to significant apple (Malus domestica Borkh.) fruit loss in stores. Penicillium expansum Link is known to be the most aggressive pathogen; however, there are other Penicillium spp. associated with blue mold. These include Penicillium polonicum Zaleski, P. solitum Westling, P. crustosum Thom, P. viridicatum Westiling, P. aurantiogriseum Dierckx and P. brevicompactum Dierckx. The objective of this study was to identify Penicillium spp. among 113 isolates collected from flotation tanks located in three apple packinghouses. Genetic characterization was performed using polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP). Internal transcribed spacer (ITS) region was amplified using ITS4 (5' TCCTCCGCTTATTGATATGC 3') and ITS5 (5' GGAAGTAAAAGTCGTAACAAGG 3') primers. The 600 base pair PCR product was then digested with HinfI and TaqI restriction enzymes and resolved on gel electrophoresis, producing characteristic DNA bands used to identify Penicillium spp. From 113 isolates tested, 108 (96%) were identified as P. expansum/P. polonicum and five (4%) as P. solitum/P. crustosum. PCR-RFLP was unable to distinguish between two sets of Penicillium spp.: P. expansum and P. polonicum along with P. solitum and P. crustosum. Future research will include random amplification of polymorphic DNA (RAPD) fingerprinting to help differentiate between these species.

Regional ascospore detection correlates to disease incidence providing accurate timing for disease management of sclerotinia rot of carrot. M. PARKER, M. R. MCDONALD AND G. J. BOLAND

Department of Plant Agriculture, Crop Science Building, University of Guelph, 50 Stone Road East, Guelph, ON N1G 2W1, Canada; and (G.J.B.) School of Environmental Sciences, University of Guelph, Guelph, ON N1G 2W1, Canada

Sclerotinia rot of carrot (SRC), caused by Sclerotinia sclerotiorum (Lib.) de Bary, is an important disease of carrot (Daucus carota L. subsp. sativus); epidemics are sporadic but infection can be severe, particularly in postharvest storage. The objective of this study was to determine the relationship between ascospore counts and disease incidence to improve the timing of disease management practices against SRC. In 2008, ascospore counts remained below the SRC forecast model threshold of 5 ascospores (0–4.4, with single peaks of 11.8 and 28.5 at two test sites) and there was low incidence of SRC at all three test sites (0–3%, with a single peak at one test site of 14%). Considering a one week delay between ascospore detection and infection, the mean daily number of ascospores were correlated with disease incidence at all sites (r = 0.78–0.87, P = 0.0026–0.0118). In 2009, at two of four test sites, low numbers of ascospores were detected (0–4.3 with a single peak of 9) and showed similar trends with low disease incidence (0–4%). At the remaining two test sites, ascospore counts surpassed the SRC forecasting model threshold (0–31.7) and were correlated with disease incidence (r = 0.74 and 0.88, P = 0.0097 and 0.0095, respectively). Trimming the carrot canopy in combination with boscalid or 0.2% chitosan timed according to ascospore detection reduced SRC compared to the untrimmed/untreated control (AUDPC: trim + boscalid or chitosan 22 and 70, respectively; boscalid or chitosan alone 215 and 252, respectively; control 564; P < 0.0001). These results indicate that disease prediction is accurate and demonstrate that control is effective when accurately timed according to inoculum detection.

Screening for myclobutanil resistance in Erysiphe necator , the causal agent of grape powdery mildew. K. REEH, L. I. WAINMAN AND D. ERRAMPALLI

Southern Crop Protection and Food Research Centre, Agriculture and Agri-Food Canada, Vineland Station, 4902 Victoria Avenue North, ON L0R 2E0, Canada

Grape powdery mildew, caused by Erysiphe necator Schwein., is an economically important fungal disease of grape (Vitis vinifera L.) worldwide. Myclobutanil, a triazole fungicide, is one of the fungicides used as a part of integrated pest management programmes for the control of grape powdery mildew. Resistance of E. necator to myclobutanil in Ontario was first reported in an experimental orchard in 2001. Isolates of E. necator were collected in 2008 and 2009 from a vineyard in Jordan Station, Ontario and screened for resistance to myclobutanil. A total of 24 isolates in 2008, and 18 isolates in 2009, were screened at concentrations of 3.2, 5.0 and 10.0 μg mL⁻¹ of myclobutanil. In 2008, 38% of the isolates were myclobutanil-sensitive, with 33% myclobutanil-resistant at 5 μg mL⁻¹ and 29% at 3.2 μg mL⁻¹. In 2009, 50% of the isolates were myclobutanil-sensitive, while 11% isolates showed resistance at 10 μg mL⁻¹ of myclobutanil, and 22% and 17% showed resistance at 5.0 and 3.2 μg mL⁻¹, respectively. The increase in resistance in E. necator isolates may suggest that the use of myclobutanil over the years may increase resistance to this fungicide. Further screening of field isolates of E. necator will be conducted to confirm these preliminary results.

Effect of organic amendments on the susceptibility of tomatoes to late blight under plastic-tunnel and greenhouse conditions. K. SHARMA, E. SCHULTE-GELDERMANN, C. BRUNS AND M. R. FINCKH

Faculty of Organic Agricultural Sciences, Department of Ecological Plant Protection, University of Kassel, Nordbahnhofstrasse. 1a, D-37213, Witzenhausen, Germany

Late blight, caused by Phytophthora infestans (Mont.) de Bary, is one of the most destructive diseases of tomatoes (Solanum lycopersicum L.) affecting tomato production worldwide. The effects of three biofertilizers (BF) (Horn meal, BioFeed Basis and Bio-ILSA), and three plant strengtheners (PS) (Alfalfa extract, PEN and BiofeedQUALITY) were assessed on plant susceptibility. Chemical fertilizer applications and BABA (DL-3-amino-n-butyric acid) were used as controls. Up to six tomato varieties were grown in a commercial-type set-up in a plastic tunnel or in the greenhouse. Detached leaves were inoculated in the laboratory with 20 μL of solutions of 5 × 10⁴ P. infestans sporangia mL⁻¹ using six different isolates. Per cent diseased leaf area was assessed daily from day four depending upon the experiment and area under the disease progress curve (AUDPC) was calculated. Both BioFeed Basis and Bio-ILSA significantly reduced disease severity under different soil and environmental conditions as compared with chemical fertilizer or Horn meal with no interaction with variety and pathogen isolates. All PS significantly reduced late blight susceptibility with a strong significant interaction with tomato varieties and pathogen isolates. The ranges of reduction in AUDPC relative to the water control across tomato varieties and isolates were 23–78%, 21–77%, 17–66% and 37–100% for Alfalfa extract, PEN, QUALITY and BABA, respectively. The lack of interactions between fertilizers and inducers suggests that studies on inducibility may be conducted without regard to the growing system such as organic or conventional. However, the isolate and variety specific interactions with the PS need to be considered carefully.

Construction of a Soybean mosaic virus -based vector and assessment of its application for studying gene functions in soybean through virus induced gene silencing. H. SUN, R. V. CHOWDA-REDDY AND A. WANG

Southern Crop Protection and Food Research Centre, Agriculture and Agri-Food Canada, 1391 Sandford Street, London, ON N5V 4T3, Canada

Virus-induced gene silencing (VIGS) is an attractive method for studying gene function in plants. In comparison with low efficiency and lengthy time consumption of genetic transformation, viral VIGS vectors have many advantages such as speed of expression, reduced cost and duration of R&D studies, and high efficiency throughout. Soybean mosaic virus (SMV) is the most common viral pathogen of legumes with soybean as the primary host. SMV is a member of potyviruses that constitute the largest family of plant viruses and account for about 30% of known plant viruses including many agriculturally important viruses. SMV was chosen for the development of a viral vector for studying gene functions in soybean and related legumes through VIGS. An SMV-L isolate previously identified in a soybean grown field in London, Ontario was used. The full cDNA of SMV-L was synthesized and cloned into a pBR322-derived vector to generate clone pSMV-L. The SMV-L cDNA was driven by the 35S promoter. Upon delivery of this plasmid into Williams 82, an SMV-susceptible soybean cultivar, the plants produced typical systemic symptoms as induced by the SMV-L isolate. To test if this clone can be induced as a VIGS vector, a partial cDNA of Phytoene Desaturase (PDS) gene in soybean was amplified and inserted between P1 and HC-Pro and between NIb and CP cistrons in pSMV-L to generate plasmids pSMV-L-PDS1 and pSMV-L-PDS2, respectively. These two plasmids were biolistically bombarded onto the 14-day-old Williams 82 soybean seedlings. ELISA analysis indicated that pSMV-L-PDS1 was infectious and induced SMV-L-like symptoms while pSMV-L-PDS2 was non-infectious. However, no obvious silencing phenotype of PDS was observed in SMV-L-PDS-infected soybeans, possibly due to the strong suppression of VIGS by the viral HC-Pro, a well-known gene silencing suppressor. The partial PDS gene fragment was further inserted into pSMV-L downstream of the CP cistron either before or after the stop codon of the open reading frame. The resulting plasmids were non-infectious, demonstrating that, like the NIb-CP junction, downstream of CP is not suitable for insertions. Taken together, our data suggest that the SMV-based vector may not be suitable for being developed as a VIGS vector.

Evaluation of Ranman 400SC for control of cavity spot on carrot. M. T. TESFAENDRIAS, K. VANDER KOOI AND M. R. MCDONALD

Department of Plant Agriculture, Crop Science Building, University of Guelph, 50 Stone Road East, Guelph, ON N1G 2W1, Canada

Cavity spot of carrot (Daucus carota L., subsp. sativus), caused by several species of Pythium, is an important soilborne disease of carrots in Canada. Field trials were conducted in the Holland/Bradford Marsh region of Ontario in 2008 and 2009 to determine the efficacy of fungicide Ranman® 400SC (cyazofamid 34.5%) on cavity spot incidence and severity. Carrot samples were harvested on 9 September and 27 October, 2008 and in 2009, the first samples were harvested on 18 August. Disease incidence and severity were higher in the untreated control at both assessment dates in 2008. Disease incidence was lower when Ranman (152 g a.i. ha⁻¹) was applied 14 days after seeding (DAS) (33.3%) compared to 3 DAS (44.0%), but no difference was observed in disease severity index (DSI) between the two applications. In the November-harvested samples, carrots treated with Ranman 400SC 14 DAS had lower disease incidence than Ridomil Gold® 480 SL (metalaxyl-M 480 g L⁻¹) treated (51.3%) and untreated carrots (53.3%). Cavity spot pressure was much higher in 2009, with 95% disease incidence in the untreated check at the August assessment. High cavity spot levels may be associated with the above average rainfall in July. No differences in disease incidence and DSI were observed among treatments in the first assessment. Application of Ranman 400SC within three days or 14 DAS may be more effective in reducing cavity spot when disease pressure is moderate.

Screening for translation initiation factors that are required for turnip mosaic virus infection. C. W. ZHANG, Y. Z. LI, M. BERNARDS AND A. WANG. (C.W.Z., Y.Z.L., A.W.) Southern Crop Protection and Food Research Centre, Agriculture and Agri-Food Canada, 1391 Sandford Street, London, ON N5V 4T3, Canada; and (C.W.Z., Y.Z.L., M.B., A.W.) Department of Biology, The University of Western Ontario, 1151 Richmond Street, London, ON N6A 5B7, Canada

Turnip mosaic virus (TuMV) is a member of the genus Potyvirus in the family Potyviridae. It is the most prevalent viral pathogen of cruciferous plants including canola. Like other positive-sense single-stranded RNA viruses, TuMV has a small genome and thus must recruit host gene products (host factors) to complete its infection cycle. The mutation or down-regulated expression of host factor(s) may lead to the generation of genetic resistance to TuMV and other related viruses. Based on previous studies, the first step of the virus replication process is to translate the viral genome. This step is fully dependent on the host translation machinery. Indeed, several eukaryotic translation initiation factors including eIF4E and eIF4G or their isoforms have been found to be essential in virus infection. To investigate if any other eIFs are also required for TuMV infection, we carried out an extensive screening using the T-DNA mutants of the model plant Arabidopsis thaliana. In the Arabidopsis genome, there are approximately 100 eIFs (http://www.arabidopsis.org/browse/genefamily/eIF.jsp), for which T-DNA insertion lines are available for 88 from the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). We selected 88 T-DNA lines (corresponding to the 88 eIFs) that contain a T-DNA insertion in the 5' UTR or coding region. Using PCR screening, we successfully recovered 58 homozygous lines. These mutants as well as the wild type control were challenged with a recombinant TuMV carrying a marker gene encoding green fluorescence protein (GFP). Enzyme-linked immunosorbent assay (ELISA) and confocal microscopy were used to examine if these mutants were susceptible to TuMV. It was revealed that 12 mutant lines showed only mild symptoms and exhibited partial resistance to TuMV. Of them, an eIF1A-like gene mutant showed no obvious symptoms with significantly reduced virus accumulation. The other 46 mutant lines were susceptible to TuMV to the same extent as the wild type. Those mutants, particularly the eIF1A-like gene mutant, are currently being subjected to further molecular characterization to explore the molecular mechanism by which it associates with virus infection.