![Sample our Bioscience journals, sign in here to start your access, Latest two full volumes FREE to you for 14 days]({"type":"image" , "src" : "/sda/5925/TOC-Subject-Sample-2021-Bioscience.jpg"})
Abstract
The RNA PK5 (GCGAUUUCUGACCGCUUUUUUGUCAG) forms a pseudoknotted structure at low temperatures and a hairpin containing an A · C opposition at higher temperatures (J. Mol. Biol. 214, 455–470 (1990)). CD and absorption spectra of PK5 were measured at several temperatures. A basis set of spectra were fit to the spectra of PK5 using a method that can provide estimates of the numbers of A · U, G · C, and G · U base pairs as well as the number of each of 11 nearest-neighbor base pairs in an RNA (Biopolymers 31, 373–384 (1991)). The fits were close, indicating that PK5 retained the A conformation in the pseudoknot structure and that the fitting technique is not hindered by pseudoknots or A · C oppositions. The results from the analysis were consistent with the pseudoknotted structure at low temperatures and with the hairpin structure at higher temperatures. We concluded that the method of spectral analysis should be useful for determining the secondary structures of other RNAs containing pseudoknots and A · C oppositions.