Identification mutation of the CACNA2D1 gene and its effect on somatic cell score in cattle

Abstract

The objective of this study was to identify single nucleotide polymorphisms (SNPs) in the bovine calcium channel, voltage-dependent, alpha-2/delta subunit 1 (CACNA2D1) gene and to evaluate the association of SNPs with mastitis in cattle. Through polymerase chain reaction – single strand conformation polymorphism (PCR-SSCP) analysis and DNA sequencing, a new mutation C367284A was detected in the cattle CACNA2D1 gene. Altogether 240 dairy cattle of three breeds (Holstein, Simmental and Sanhe) were genotyped and allele frequencies were determined. The effects of CACNA2D1 polymorphisms on somatic cell score (SCS) were analysed, and a significant association was found between C367284A and SCS. CC genotype had the lowest SCS. The results of this research will be useful in further studies to determine the role of the CACNA2D1 gene in mastitis resistance, and further work will be necessary to investigate whether the CACNA2D1 gene plays a role in defending the host from mastitis.

Keywords:

• association analysis
• CACNA2D1 gene
• dairy breeds
• mastitis
• somatic cell score

Introduction

Mastitis is one of the major causes of economic loss to the dairy industry worldwide (Nash et al. 2003; Ruegg 2003). Mastitis is mainly caused by pathogens, which can be divided into contagious and environmental pathogens, poor management practices, genetic factors and health of the dairy cattle. Classical detection and mapping of genes, genetic markers and quantitative trait loci (QTL) can be used to enhance genetic improvement of breeding stock through marker or gene-assisted selection. Identification of genetic polymorphisms underlying genetic variation in mastitis could increase the knowledge of the molecular mechanisms involved and provide a tool for improving the trait by marker assisted selection (MAS) (Opsal et al. 2008). However, it is difficult to make appreciable genetic progress by traditional breeding methods because the heritability of this trait is low (Heringstad et al. 2000; Hansen et al. 2002; Carlén et al. 2004) and there is unfavourable genetic correlation with production traits (Carlén et al. 2004). Because the trait is difficult to record objectively, resistance to mastitis is still a candidate for MAS and many studies have reported QTLs affecting this trait. At present, several studies have identified several QTLs for somatic cell score (SCS) and clinical mastitis (CM). It is concluded that many of the genes affecting SCS also affect CM. SCS is easier to record and used as an indicator trait for CM, as the genetic correlation is around 0.7 (Carlén et al. 2004; Heringstad et al. 2006). Since it is difficult to measure the mastitis phenotype using a direct index, milk SCS has been most widely used as an indirect way to evaluate mastitis. The calcium channel, voltage-dependent, alpha-2/delta subunit 1 (CACNA2D1) gene encodes for a member of the alpha-2/delta subunit family, a protein in the voltage-dependent calcium channel complex. The cattle CACNA2D1 gene has been mapped to BTA 4q18 (Buitkamp et al. 2003). It is located within the genomic region of SCS QTL (Rupp and Boichard 2003) and nearby the QTL of SCC (Longeri et al. 2006; Daetwyler et al. 2008) (http://www.animalgenome.org/cgi-bin/QTLdb/BT/draw_chro-map?optqtl=,chromos=4,orderqtl=QTL_symbol,scale=4,density=10,submit=GO). Therefore, the CACNA2D1 gene is considered to be one of the potential candidate genes influencing SCS and mastitis. The purpose of this study was to identify single nucleotide polymorphisms (SNPs) in the bovine CACNA2D1 gene and analyse the association between SNPs and SCS in dairy cattle.

Materials and methods

Animals of this study consisted of 73 Holstein (Caotan Dairy Farm, Xi'an, Shaanxi Province, China), 78 Sanhe (Xiertala Breeding Farm, Hailar, Inner Mongolia Autonomous Region, China) and 89 Simmental cows (Gaolintun Breeding Farm, Tongliao, Inner Mongolia Autonomous Region, China). Genomic DNA was extracted from whole blood by the standard phenol/chloroform/isoamyl alcohol extraction protocol (Mullenbach et al. 1989), then dissolved in TE buffer (10 mmol/l Tris-HCl and 1 mmol/l EDTA, pH 8.0) and kept at –20°C. The milk samples, including an antiseptic, were collected and sent to Beijing Dairy Cattle Centre for somatic cell count (SCC) detection and converted into SCS, using the formula: SCS=log2(SCC/100000) + 3. All experimental protocols and care of the animals were performed according to authorisation granted by the Chinese Ministry of Agriculture.

The mRNA (GenBank NO. XM_609993.4) and DNA sequences (GenBank NO. NC_007302.4) of the bovine CACNA2D1 gene were used for primers design using Primer Premier5.0 software (Premier Biosoft International, Palo Alto, CA). Primer sequences and their corresponding amplified fragment sizes and region are shown in Table 1. The polymerase chain reactions (PCRs) were carried out in a total volume of 20 µl solution containing 50 ng template DNA, 1× buffer (Tris-HCl 100 mmol/l, pH 8.3; KCl 500 mmol/l), 0.25 µmol/l primers, 2.0 mmol/l MgCl₂, 0.25 mmol/l dNTPs, and 0.5U Taq DNA polymerase (Promega, Madison, WI, USA). The PCR protocol was 94°C for 5 min, followed by 35 cycles of 94°C for 30 s, annealing at the corresponding temperature (Table 1) for 30 s and 72°C for 30 s, and a final extension at 72°C for 8 min. The PCR products were separated on 1.5% agarose gel (Promega) including 0.5 µg/ml of ethidium bromide, photographed under UV light.

Table 1. Primer pairs designed for the bovine CACNA2D1 gene.

Name		Primer sequence	Ampicon length (bp)	Annealing temperature (°C)	Region
C367284A	FOR:	5′- ATCTTGAAAGGGTTGTCCTGCCATC -3′	225	64.5	Intron5
	REV:	5′- TTCCCATCTAAATTACTGCCCATAG -3′

Single stranded conformation polymorphism (SSCP) method was used to scan mutations within the amplified regions. Aliquots of 5 µl PCR products were mixed with 5 µl denaturing solution (95% formamide deionised, 25 mM EDTA, 0.025% xylene-cyanole and 0.025% bromophenol blue), heated for 10 min at 98°C and chilled in ice immediately for 5 min. Denatured DNA was subjected to 10% PAGE (polyacrylamide gel electrophoresis) in 1× TAE buffer and constant voltage (140 V) for 10–12 h at a constant temperature of 4°C, and then gels were stained with 0.1% silver nitrate. After polymorphism was detected, the PCR products representing different electrophoresis patterns in different breeds were subcloned to T-vector (Promega) and sequenced in both directions in ABI PRISM 377 DNA sequencer (Perkin Elmer Applied Biosystems, Foster City, CA, USA) by Shanghai Invitrogen Biotechnology Ltd. Co. (Shanghai, P.R. China).

Analysis of associations between the genotypes of SNPs and SCS that reflect mastitis traits was carried out with the general linear models (GLM) procedure, using SAS (1999) software by the following formula: y _ijklm=µ+b _i+f _j+a _k+p _l+ g _m+h _n+e _ijklmn, where y _ijklm=lactation average SCS, µ=global mean, b _i=breed effect, f _j=calving number effect, a _k=age-year-season effect, p _l=lactation month effect, g _m=genotype effect, h _n=herd effect, e _ijklmn=residual.

Results and discussion

Recent advances in molecular biotechnology provided great opportunities to incorporate molecular information into the traditional genetic evaluation models and to improve selection accuracies in livestock populations. These advancements have enabled the detection of some of the genes that contribute to genetic variation in economically important quantitative traits. Improving resistance to mastitis is an important breeding objective. However, for many years, breeding goals for dairy cattle had focused mainly on increasing the productivity and had ignored health traits such as disease resistance. Higher yielding cows tend to have higher health costs. For instance, mastitis is the most prevalent production disease in dairy herds worldwide and is responsible for several effects on production. Milk production losses, drugs, discarded milk, veterinarian service, labour, milk quality impairment and culling of cows are the economic damage of mastitis. Prospects for the development of an effective vaccine are limited by the variety of microorganisms causing mastitis and by a lack of information on the genetic factors that influence disease resistance.

The interest in selection for resistance to health problems in the dairy industry, as well as the selection for improvement of the health of livestock for consumers, is internationally of increasing importance (Stear et al. 2001). But unfortunately, health traits usually have low heritabilities and limited amount of data, which hamper the potential for genetic improvement by traditional selection methods. Consequently, there has been considerable interest in defining genetic and immunological markers that could be used to select for improved disease resistance (Park et al. 2004). The candidate gene approach may provide a more direct understanding of the genetic basis for the expression of quantitative differences between individuals (Noguera et al. 2003) and revealing genomic regions and specific markers that are associated with traits. In the present study, CACNA2D1 was considered to be a potential candidate gene influencing mastitis, because the cattle CACNA2D1 gene has been mapped to BTA 4q18 (Buitkamp et al. 2003) and located within the genomic region of QTL for SCS (Zhang et al. 1998; Rupp and Boichard 2003) and nearby SCC (Longeri et al. 2006). A novel SNP of the CACNA2D1 gene, which was located in Intron 5, was preliminarily identified by PCR-SSCP and DNA sequencing. Sequence analysis showed that the new allele was caused by C–A mutation at positions 367284. The mutation was detectable by PCR-SSCP method. In the three researched populations, nucleotide A of C367284A was the predominant nucleotide and the frequencies of the AA of C367284A were highest in all populations except for CC of C367284A, which were highest in the Simmental population. The genotypic and allelic frequencies of the CACNA2D1 gene in 240 cattle are presented in Table 2. The analysis of variance on SCS was calculated using the model with genetic marker effect (Table 3). Table 3 showed that breed, age-year-season, calving number and genotype of SNPs affected SCS significantly, but the lactation month effect of cattle on SCS was not significant. The effects of the PCR-SSCP po1ymorphism genotypes and the associations between the genotypes and SCS were analyzed. Significant association between the C367284A locus and SCS was found (P=0.037). Individuals of genotype CC had significant lower SCS than those of genotype CA and AA (Table 4). Furthermore, the SCS of Holstein cows being significantly higher than that of the Sanhe and Simmental cows, and the SCS of the Sanhe cows being significantly higher than that of Simmental cows (Table 5), led to the conclusion that dairy cattle were less resistant to mastitis than dual-purpose breeds. Zhang et al. (2009) and Wang et al. (2007) had reported similar results (Wang et al. 2007; Zhang et al. 2009). The calving number and age-year-season also significantly affected the SCS (P <0.01), but the lactation month of the cows did not influence SCS significantly. Results from this study indicate that that the CACNA2D1 gene has potential effects on SCS and mastitis resistance. To further study gene variants and their correlation with improved mastitis-resistance performance, we should choose a large size of sample and testify the real relationship between polymorphism of CACNA2D1 gene and trait of mastitis resistance.

Table 2. Genotypic and allelic frequencies of C367284A in three cattle breeds.

		Genotype frequencies (number)			Allelic frequencies
Breeds	Number	CC	CA	AA	C	A
Holstein	73	0.1781 (13)	0.2603 (19)	0.5616 (41)	0.3082	0.6918
Sanhe	78	0.2051 (16)	0.2949 (23)	0.5000 (39)	0.3526	0.6474
Simmental	89	0.4944 (44)	0.2022 (18)	0.3034 (27)	0.5955	0.4045

Table 3. Effects of different factors on somatic cell score.

Factors SNP		Breeds	Age-year-season	Calving number	Lactation month	Genotype of SNP
C367400T	F value	23.33**	5.11**	3.79*	2.29	0.035*
*P <0.05;**P <0.01

Table 4. Association of SNPs with somatic cell score.

SNP	Genotype	SCS (LSM±SE)
C367284A	CC	2.9543±0.7243
	CA	3.6362±0.8333
	AA	3.7265±0.8547
	P-value	0.037
Least squares means with the different superscripts differ significantly (P <0.05).

Table 5. Effects of different breeds on somatic cell score.

SNP	Breeds	SCS (LSM±SE)
C367284A	Holstein	5.3343±0.8026a
	Sanhe	4.4653±0.8145b
	Simmental	2.9169±0.8159c
Least squares means with the different superscripts differ significantly (P < 0.05).

Acknowledgements

This research was financially supported by the earmarked fund for Modern Agro-industry Technology Research System (No.nycytx-38) and the Eleventh ‘Five-Year’ National Science and Technology Support Project (No. 2006BAD04A16 and No.2007BAD56B04).