The effects of raising system on the lipid metabolism and meat quality traits of slow-growing chickens

Abstract

We investigated the effects of different raising systems on growth performance, lipid deposition and meat quality traits of chickens. The chickens were raised for 28 days and then randomly assigned into three raising systems with similar body weight (BW) as follows: indoor caged, indoor floor pens and free-range system. They were sacrificed and analysed after 112 days. The raising system had no significant effect on BW and daily weight gain (P > 0.05), but had a significant effect on male thigh intramuscular fat (IMF) and female abdominal fat content (PAF) content (P < 0.05). The expression of hepatic fatty acid synthase (FAS) mRNA level in free-range raising system was significantly lower than that of caged indoor raising systems (P < 0.05). The meat quality (ΔpH, drip loss, shear force and fibre traits) was largely affected by the raising system (P < 0.05). In conclusion, the data indicated that the free-range raising system could significantly reduce thigh IMF content and hepatic FAS expression, consequently affecting the meat quality.

Keywords:

• free-range
• raising system
• slow-growing chickens
• lipid metabolism
• meat quality

1. Introduction

Consumers favour meat from broilers raised with outdoor access or free range, which is the conventional raising mode of slow-growing chickens in China. Many consumers believe that these products have superior meat quality. Meat from such animals has better sensory qualities due to the free access to fresh grass (Jahan et al. 2005). The meat of animals raised outdoor is reported (Smith et al. 2012) to have superior quality and tenderness, and other studies have shown that there are no differences in meat quality of broilers (Wang et al. 2009) reared outdoor or indoor. Maybe genotypes and growth rate have significant effects on the sensory attributes of meat (Fanatico et al. 2007; Sarica et al. 2011).

Intramuscular fat (IMF) content is a major determinant of meat quality (Zhao et al. 2007), particularly influencing sensory characteristics, tenderness and physical attributes. Since it can be precisely quantified, IMF is a useful objective index of meat quality. Therefore, the raising system may have an important effect on the chicken lipid metabolism and IMF deposition.

Hetian chicken is a native, slow-growing, yellow-feathered breed of southern China, and it is regarded to have superior meat quality. In our present study, we raised Hetian chicken in three raising systems. We aimed to compare the effects of different raising systems on several endpoints related to the IMF deposition.

2. Materials and methods

All animal procedures and care were performed in accordance with the Guidelines for Experimental Animals established by the Ministry of Science and Technology (Beijing, China).

2.1. Animals, diets and management

The experiment was conducted at the Academy of Agricultural Sciences of Fujian Province in China from March to July 2011. A total of 380 male and female, slow-growing native Chinese chickens were raised in indoor floor pens. After 28 days, they were randomly assigned into three raising systems with four replicates as follows: (1) chickens in the indoor cages; (2) chickens in the indoor floor pens; and (3) chickens in the free-range with daily access to outdoor.

The metal cages were placed indoor, and each cage (1.5 × 2 m) contained 15 chickens (5 chickens/m²). The indoor floor pens were conventional poultry research houses, and each pen (4.5 × 4 m) contained 30 chickens (1.7 chickens/m²). The chickens in the free-range raising system were raised in outdoor yards from 07:00 to 19:00 and then kept indoor during the night. A total of 50 chickens (1 chicken/m²) were raised in each outdoor yard (8.5 × 6 m), covered with native grass and shade available. The average daily outdoor temperature ranged between 20° and 26°C, which is quite suitable for these birds. The indoor condition was the same, the temperature was 20 ± 2°C, the RH was 65–70% and the photoperiod was 12 h.

All chickens were provided with ad libitum water and same diets in four stages as follows: 0–4 weeks, 5–8 weeks, 9–12 weeks and 13–16 weeks. The diets were formulated to meet nutrient requirements for Chinese yellow-feathered chickens (see Table 1). Individual live weight and feed consumption for each replicate were recorded at 8, 12 and 16 weeks of age, respectively. Feed conversion ratios were calculated on a per replicate basis including the weight of any dead bird. Bird mortality was daily recorded.

Table 1. The nutritive value of experimental diet.

Nutrients	0–4 weeks	5–8 weeks	9–12 weeks	13–16 weeks
CP (g/kg)	215	194	181	175
ME (MJ/kg)	12.35	12.51	12.76	12.92
Calcium (g/kg)	8.7	8.6	8.6	8.5
Total phosphorus (g/kg)	6.2	6.0	0.58	0.53
Available phosphorus (g/kg)	4.5	4.5	4.3	4.2
Lysine (g/kg)	11.7	10.4	9.2	8.8
Methionine (g/kg)	4.9	4.6	3.5	3.4
Vitamin–mineral–premix^a	10	10	10	10

^a Vitamin–mineral–premix provided the following per kilogram of diet: vitamin A, 12,000 IU; vitamin D3, 3500 IU; vitamin E, 25 IU; nicotinic acid, thiamin 60 mg; vitamin B12, 0.014 mg; calcium pantothenate, 20 mg; vitamin K3, 2.0 mg; thiamin, 2.0 mg; riboflavin, 8.0 mg; vitamin B6, 7.0 mg; folic acid, 0.8 mg; biotin, 0.2 mg; Fe, 100 mg; Cu, 8 mg; Mn, 120 mg; Zn, 100 mg; I, 0.7 mg; Se, 0.3 mg.

2.2. Sample collection and fat analysis

At 16 weeks of age, six females and six males were randomly selected from each raising system (a total of 18 for each sex) and sacrificed. Feeding was withheld for 12 h before sacrifice. Chickens were scalded at 65–70°C for 3 min. Immediately after de-feathering, the liver was collected and stored in liquid nitrogen until the analysis of fatty acid synthase (FAS) and malic enzyme (ME) at the mRNA level. Breast and thigh muscle (right side) were stored at −20°C until the IMF analysis by ether extraction in a Soxhlet apparatus (Zhao et al. 2007). The abdominal fat content (PAF) was defined as the percentage of carcass weight. The IMF was defined as the percentage of dry muscle weight for breast (B-IMF) and thigh (T-IMF).

2.3. Meat quality traits

Samples were collected to determine the drip loss, shear force and histological characteristics. The left side thigh muscle pHi was measured at 45 min and pHu at 24 h after killing using a pH metre equipped with an electrode and a temperature probe. Before measurement, the pH electrode was calibrated using the standard calibration buffer (pH 7.00). The measurement was always taken placed at the same place. The average pH value was obtained from three measurements of the same muscle sample. The ΔpH was expressed as the differential value of pHi and pHu.

Drip loss was measured as the weight change during the sample storage (1.0 cm of width, 0.5 cm of thickness and 2.5 cm of length) at 2°C for 24 h. It was expressed as a percentage of the initial weight. Shear force was measured on these cooked samples (Zhao et al. 2007) and expressed in kilograms.

Histological traits (fibre diameter and fibre density) were measured by Tuma et al.'s (1962) method. Samples (1.0 cm of width, 1.0 cm of thickness and 1.0 cm of length) were dissected from the fresh muscle and then fixed in 10% formalin solution until the histological observations. A total of 20 straight fibres were measured from each sample using a compound microscope with a 10× objective lens and a 40× eyepiece containing a calibrated micrometre. All fibre diameter measurements were expressed in microns.

2.4. Expression of FAS and ME at the mRNA level

Total RNA was extracted using TRIzol reagent (Invitrogen, USA), according to the manufacturer's instructions. All purified RNA samples were diluted in RNase-free water to 1 µg/µl concentration and stored at −80°C for qRT-PCR assays. Gene-specific primers were designed by Primer Premier 5.0 from the corresponding chicken sequence to be intron spanning in order to avoid co-amplification of genomic DNA (see Table 2). Primers were obtained from Huada Biology Company (Beijing Genome Institute, Beijing, China). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an endogenous control to normalize the reverse transcription reactions.

Table 2. Gene accession numbers and primer sequences.^a

Gene	Primers (5′→3′)	Product (bp)	Genebank No.
ME	F: TGCAGAAGAAGCCTACAGGAATAAR: CAGGTGTATGAGTCAGCCACAA	126	J04485
FAS	F: CAATGGACTTCATGCCTCGGTR: GCTGGGTACTGGAAGACAAACA	119	AF408407
GAPDH	F: CTTTCCGTGTGCCAACCCCR: CAGCAGCAGCCTTCACTACC	106	AF047874

^a All primers were designed using Primer 5 software.

FAS, fatty acid synthase; ME: malic enzyme.

RT-PCR amplifications of FAS and ME transcripts were performed using an ABI PRISM 7500 apparatus (Applied Biosystems, USA) with SYBR Green I RT-PCR Master Mix Plus (Takara, Dalian, China). A total volume of 20 µl [10 µl 2× SYBR Green I RT-PCR Master Mix (ABI), 1 µl forward primer (10 pmol), 1 µl reverse primer (10 pmol), 2 µl cDNA, 0.4 µl 50× ROX Reference Dye II and 5.6 µl dH2O] was pre-heated at 95°C for 10 min followed by 40 cycles of 95°C for 15 s and 63°C for 45 s.

Data were analysed using the ABI 7500 SDS software (ABI) with the baseline being set automatically by the software, and values of average dCT (normalized using β-actin) were exported into MS Excel for the calculation of relative mRNA expression. The 2−ΔΔCt method of quantification (Livak & Schmittgen 2001) was used to calculate the relative expression levels of each gene.

2.5. Statistical analysis

Data were analysed using the analysis of variance (ANOVA) procedure of SAS (SAS Institute 2008). Differences between these means were assessed using Duncan's multiple range tests. P < 0.05 was considered as statistically significant.

3. Results and discussion

3.1. The effects of raising system on growth performance

Data showed that there were no differences among the three raising systems at 16 weeks in terms of BW and daily weight gain. However, the daily weight gain of chickens in free-range raising system was lower than that of the other two systems (P > 0.05; see Table 3). The chickens in the free-range raising system showed significantly lower feed/gain ratio than chickens in the indoor floor pens raising system (P < 0.05). In the free-range raising system, chickens have access to an outside area, promoting activity and then increasing energy consumption. Therefore, the growth rates and feed efficiencies in the free-range raising system are lower than those of conventional raising systems (Castellini et al. 2002). However, Ponte et al. (2008) showed that the chickens reach significantly greater final body weight (BW) in the free-range raising system due to the improved bird comfort.

Table 3. The effects of raising system on growth performance at 16 weeks of age.

	Body weight/g		Daily weight gain/g		Feed/gain ratio
Raising system	Male	Female	Male	Female	Male	Female
Caged indoor	1478 ± 130^a	1194 ± 50^a	11.5 ± 1.2^a	9.2 ± 0.9^a	4.18 ± 0.4^b	4.23 ± 0.3^b
Floor pens indoor	1445 ± 161^a	1189 ± 97^a	11.3 ± 1.5^a	9.1 ± 0.9^a	4.36 ± 0.3^a	4.46 ± 0.4^a
Free range	1434 ± 117^a	1236 ± 121^a	10.9 ± 1.1^a	8.9 ± 0.9^a	4.21 ± 0.3^b	4.25 ± 0.3^b

Data are overall means (±SD) for varying numbers of birds per treatment.

^a,b Means within columns with different superscripts differ significantly (P < 0.05).

3.2. The effects of raising system on the lipid deposition

Table 4 shows the effects of raising system on lipid deposition. The T-IMF content of chickens in the free-range raising system was significantly lower than that of other raising systems (P < 0.05). The raising system had no effect on the contents of B-IMF and male PAF. However, the B-IMF and male PAF contents of chickens in the free-range raising system were lower than those of other raising systems. The female PAF content of chickens in the free-range raising system was significantly lower than that of other raising systems (P < 0.05). Many studies (Lewis et al. 1997; Castellini et al. 2002) have shown that physical movement decreases lipid deposition, which was in agreement with our study. Milosevic et al. (2003) studied lipid deposition in broilers using free-range raising system and showed that the contents of IMF and PAF are decreased. The change in lipid deposition likely reflected the effect of increased activity on energy balance and lipid metabolism.

Table 4. The effects of raising system on lipid deposition at 16 weeks of age.

	T–IMF (%)		B–IMF (%)		PAF (%)
Raising system	Male	Female	Male	Female	Male	Female
Caged indoor	9.26 ± 1.01^a	12.61 ± 2.23^a	1.59 ± 0.11^a	3.41 ± 0.94^a	0.92 ± 0.35^a	2.49 ± 0.50^a
Floor pens indoor	9.08 ± 0.53^a	11.53 ± 2.66^a^,^b	1.57 ± 0.32^a	2.66 ± 0.85^a	0.82 ± 0.26^a	1.70 ± 0.54^b
Free range	7.42 ± 1.01^b	9.62 ± 3.20^b	1.51 ± 0.21^a	2.27 ± 1.53^a	0.73 ± 0.07^a	0.90 ± 0.20^c

^a–c Means within columns with different superscripts differ significantly (P < 0.05).

Results are means with n = 6 per treatment.

3.3. The effects of raising system on the mRNA expression

Table 5 shows the effects of raising system on the expression of FAS and ME at the mRNA level. The hepatic FAS expression at the mRNA level of chickens in free-range raising system was significantly lower than that of caged indoor raising systems (P < 0.05). Although there was no difference in the hepatic ME expression at the mRNA level among three raising systems (P > 0.05), it was lower in the free-range raising system than that of other raising systems. The effects of raising system on the expression of FAS and ME at the mRNA level were consistent with the lipid deposition as previously described. Therefore, the effects of raising system on the expression of FAS and ME at the mRNA level might be related to the motion intensity and energy consumption of chickens, which affected the nutrition requirement of chickens. The chickens in the free-range raising system were fed the lower nutrients under the same diet condition. Many studies have shown that gene expression and lipid synthesis are influenced by nutritional levels and diet. Hepatic ME activity is directly related to the nutrition level (Rosebrough et al. 2002). Moreover, chickens fed a high protein diet have lower lipid deposition, which may be due to the reduced activities of FAS and ME. A carbohydrate-rich diet, fed to fasting rats or broilers, can induce the ME expression at the mRNA level, thereby accelerating lipid synthesis. According to Stelmanska et al. (2005), hepatic ME expression at the mRNA level is decreased in fasting rats and can be promoted with re-feeding.

Table 5. The effects of raising system on the gene expression at the mRNA level at 16 weeks of age.

	FAS mRNA		ME mRNA
Raising system	Male	Female	Male	Female
Caged indoor	2.01 ± 0.07^a	2.13 ± 0.06^a	0.95 ± 0.08^a	0.97 ± 0.09^a
Floor pens indoor	1.93 ± 0.07^a^,^b	1.99 ± 0.09^b	0.86 ± 0.07^a	0.93 ± 0.06^a
Free range	1.86 ± 0.07^b	1.97 ± 0.06^b	0.84 ± 0.06^a	0.92 ± 0.06^a

^a,b Means within columns with different superscripts differ significantly (P < 0.05).

Results are means with n = 6 per treatment.

3.4. The effects of raising system on the meat quality traits

Muscle pH is important to estimate the meat quality. It is known that a high muscle pH decline may result in low water-holding capacity or high meat drip loss, even pale, soft, exudative (PSE) meat. Table 6 shows the effects of raising system on the muscle ΔpH. The change in pH was lower in free-range raising system than that of indoor caged raising system. Especially, the male muscle pH decline in free-range raising system was significantly different from indoor caged raising system (P < 0.05). The reason could be that the free-range raising reduced pre-sacrifice stress and energy consumption. Therefore, the intensity of muscle acidification and final meat pH decline is low (Enfält et al. 1997; Castellini et al. 2002). In our study, we obtained the similar data consistent with previous studies.

Table 6. The effects of raising system on the meat quality traits at 16 weeks of age.

	Δ pH		Drip loss (%)		Shear force (kg)
Raising system	Male	Female	Male	Female	Male	Female
Caged indoor	0.28 ± 0.02^a	0.29 ± 0.03^a	2.31 ± 0.16^a	2.88 ± 0.26^a	1.88 ± 0.26^b	2.13 ± 0.09^b
Floor pens indoor	0.25 ± 0.02^b	0.27 ± 0.02^a	2.07 ± 0.12^b	2.13 ± 0.16^b	2.13 ± 0.16^a^,^b	2.19 ± 0.06^b
Free range	0.26 ± 0.02^b	0.26 ± 0.03^a	0.89 ± 0.04^c	2.29 ± 0.19^b	2.29 ± 0.19^a	2.41 ± 0.12^a

^a–c Means within columns with different superscripts differ significantly (P < 0.05).

Results are means with n = 6 per treatment.

The meat drip loss and shear force are the important parameters in terms of the meat's tenderness and juiciness. The high drip loss or shear force may result in drier or tougher meat. Therefore, the meat quality is poor. We showed that the free-range raising system might improve the meat quality by reducing the meat drip loss. Milosevic et al. (2003) also showed that the meat shelf life of chickens raised in the free-range raising system is more acceptable, but the shear force is increased. In contrast, Hoffman et al. (2003) studied the growth and meat quality of growing pigs using outdoor and indoor feeding. There is no significant effect on the muscle water-holding capacity, initial or ultimate pH, and shear force. Table 7 shows that the male muscle diameter of chickens in the free-range raising system was significantly greater than that of other raising systems. Many studies supported our present finding that the shear force of meat from free-range raising system is higher than that of caged birds and those reared in indoor floor pens (Castellini et al. 2002). Physical movement, associated with outdoor free-range raising, induces growth and increases diameter of muscle fibres. This may be the main cause of the increased meat shear force (Vestergaard et al. 2000).

Table 7. The effects of raising system on the muscular fibre traits at 16 weeks of age.

	Diameter (um)		Density(number/mm^2)
Raising system	Male	Female	Male	Female
Caged indoor	23.55 ± 0.75^b	25.11 ± 1.81^a	773.34 ± 23.12^a	709.88 ± 56.91^a
Floor pens indoor	24.00 ± 1.14^b	25.02 ± 1.51^a	667.68 ± 35.46^c	749.62 ± 26.99^a
Free range	26.57 ± 1.26^a	25.50 ± 0.94^a	732.43 ± 20.76^b	646.34 ± 52.43^b

^a–c Means within columns with different superscripts differ significantly (P < 0.05).

Results are means with n = 6 per treatment.

4. Conclusion

From the above results, we concluded that the rearing system had different effects on the lipid metabolism of male and female chickens. Moreover, the meat quality could be improved through the rearing system. This was due to a significant regulation on the meat pH, drop loss and shear force.

Additional information

Funding

This study was supported by the Project of State Key Laboratory of Animal Nutrition [2004DA125184F1012].