Dietary addition of Humulus scandens improved the intestinal barrier in rabbits

ABSTRACT

This study was conducted to investigate the effect of Humulus scandens (HS) in diet on the production performance and intestinal barrier of rabbits. One hundred and sixty Laiwu black rabbits at 35 days of age with body weight of 692.5 ± 48.3 g were divided into four groups (five replicates per group and eight rabbits per replicate): fed on a basal diet free of HS (control), 4%, 8% or 12% HS powder supplement. The results showed that the dietary addition of HS decreased the ADFI, F/G, diarrhoea ratio and mortality ratio. Besides, the final body weight and ADG (P < .05) increased with the level of HS. Rabbits in 12% HS group had a higher sIgA and IgG concentration in serum and ileum than control, while lower TNFα, IFN-γ and IL-6 concentration (P < .05). Compared with the control, the HS supplementation groups for 12% level could decrease the mRNA expression of ZO-1, JAM3 and mucin1 (P < .05). In conclusion, dietary supplement of HS modulates immune responses and enhances intestinal barrier, meanwhile inhibits the synthesis of cytokine. Besides, our experiment offers positive evidence in improving rabbit health of HS as rabbit feed resource.

KEYWORDS:

• Humulus scandens
• intestinal barrier
• rabbits
• production performance

1. Introduction

The disease of digestive tract is the most important disease in rabbits, accounting for 70% (Carabaño et al. 2008). The mortality of the weaned rabbits up to 60% due to epizootic rabbit enteropathy (Fann et al. 2001; Carabaño et al. 2008). Rabbit diarrhoea is a big problem in present rabbit production, especially in the weaning stage (Martens and Van Herck 2000). Weaned rabbits had thinner intestinal walls, incomplete intestinal barrier, frequent diarrhoea or gastrointestinal flatulence (Fann et al. 2001). Antibiotics have been widely used to control mortality, increase breeding costs, affect product quality and reduce the economic benefits of many farms. For this reason, some herbs and plant extracts to substitute antibiotic have been found and studied by many researchers. Humulus scandens (HS) is widely used in China to treat dysentery and chronic colitis as one traditional Chinese medicine, and contains polysaccharides, flavonoids, volatile oil and other chemical components (Chen et al. 2012). Li et al. (2008) had reported that HS was rich in flavonoids and there have been three kinds (vitexin, luteolin and cosmosiin) of flavonoids separated from HS. Flavonoids are a kind of common polyphenols in the plant world. They have biological activities such as anti-inflammatory, anti-oxidant and anti-cancer (Korkina and Afanas’ev 1997; Neuhouser 2005; Talhouk et al. 2007; Zhang et al. 2021; Nath et al. 2022). Li et al. (2022) flavonoids could inhibit alcohol-induced hepatocyte injury, which might be attributed to alleviating oxidative stress and mitigating inflammatory response by activating Nrf2 and inhibiting NF-κB pathways. In addition, it is reported that flavonoids play a strong immune role by inhibiting the proliferation of immune cells and the production of pro-inflammatory cytokines (Rios 2010). HS is wild on the roadside in the field, which adapts to various environmental conditions and has high yield (Urziceanu et al. 2022). In addition, because of its strong vitality and harm to the growth of crops, it is often regarded as a malignant weed, so far it has not been systematically developed and utilized, resulting in serious waste of resources (Zhou and Feng 2020). However, there was little information available about HS use as feedstuff in rabbit production and special its effect on improving intestinal barriers. The present experiment was conducted to investigate the effect of HS on the performance and intestinal barrier of rabbits, to identify applicative effects HS as a feed resource in rabbit production.

2. Materials and methods

2.1. Production of HS powder

Harvest the HS from countryside in Shandong Province in the autumn mature stage, and naturally drying and pulverizing.

2.2. Animals, diet and feed chemical composition

One hundred and sixty Laiwu black rabbits (male–female rate of 1:1) at 35 days of age weight of 692.5 ± 48.3 g were divided into four groups (five replicates per group and eight rabbits per replicate): f fed on a basal diet with 0 (control), 4%, 8% or 12% HS powder, and the chemical of HS were listed in Table 1. The basal diets were formulated according to the values for growing from De Blas and Mateos (2020) and the ingredients and composition of diet are listed in Table 2. Besides, the diet pelleted by the use of pressure and the diameter of the pellets was 4 mm. The experiment lasted for nine weeks which included one week adaptation period and eight weeks experimental period. During the rearing period, the rabbits were individually housed cage and had free access to feed and water.

Table 1. Chemical composition of Humulus scandens powder (air-dry basis, %).

Items	Humulus scandens powder
Dry matter (DM)	91.60
Crude protein (CP)	16.00
Ether extract (EE)	0.90
Neutral detergent fibre (NDF)	47.40
Acid detergent fibre (ADF)	36.90
Aid detergent lignin (ADL)	9.20
Ash	16.50
Calcium	1.93
Phosphorus	0.35
Polysaccharide (mg/g)	19.53
Total flavonoids (mg/g)	6.86

Table 2. Composition and nutrient levels of basal diets (air-dry basis, %).

Items	Levels of Humulus scandens
	0 (Control)	4	8	12
Raw material composition
Corn	15.0	15.0	15.0	15.0
Soybean meal	10.0	10.0	10.0	10.0
Wheat bran	20.0	20.0	20.0	20.0
Corn germ meal	15.0	15.0	15.0	15.0
Soybean straw powder	7.0	7.0	7.0	7.0
Peanut seedling powder	30.0	26.0	22.0	18.0
Humulus scandens	0.0	4.0	8.0	12.0
Premix^a	3.0	3.0	3.0	3.0
Total	100.0	100.0	100.0	100.0
Nutrient levels^b
Digestible energy (DE, MJ/kg)	10.14	10.21	10.26	10.29
Crude protein (CP)	15.10	15.60	16.30	16.70
Ether extract (EE)	2.00	2.10	2.20	2.50
Neutral detergent fibre (NDF)	56.80	56.70	52.50	50.00
Acid detergent fibre (ADF)	43.30	43.00	41.40	40.60
Aid detergent lignin (ADL)	5.77	5.80	5.41	5.32
Ash	11.60	11.20	11.80	11.10
Calcium	1.27	1.14	1.26	1.19
Phosphorus	0.62	0.67	0.75	0.68

^a Premix provided the following per kg of diets: vitamin A 10,000 IU, vitamin D₃ 2000 IU, vitamin E 50 mg, vitamin K₃ 2.5 mg, thiamine 5 mg, riboflavin 10 mg, nicotinic acid 20 mg, pantothenic acid 50 mg, folic acid 2.5 mg, vitamin B₁₂ 1 mg, choline chloride 400 mg, iron 100 mg, zinc 50 mg, copper 40 mg, manganese 30 mg, iodine 0.5 mg, selenium 0.05 mg, calcium hydrogen phosphate 15 g, sodium chloride 5 g, lysine 1.5 g, methionine 1.5 g, the rest is miscellaneous meal carrier complement.

^b Digestible energy was calculated, whereas the others were measured values.

2.3. Sample collection and preparation

At the end of the trial (98 days), 40 rabbits (10 rabbits per group, male and female had half each, and the average body weight of the two rabbits equals to the average body weight of each replicate) were sacrificed by cervical dislocation. About 4 cm segment of the middle ileum was collected and divided into two segments. One intestinal segments were flushed gently with phosphate-buffered saline (PBS, pH 7.4) and then placed in 10% fresh, chilled formalin solution for histological measurements. The other intestinal segments were collected by cryopreservation tube, rapidly frozen in liquid nitrogen and stored at −80°C until analysis.

2.4. Determination of indicators and methods

2.4.1. Feed chemical analysis

The chemical composition of the SH and diets was analysed following the procedures of AOAC International (2005). The dry matter was determined by oven drying at 105°C (procedure 934.01), and the ether extract was determined by extraction with petroleum ether in a Soxtec 1043 apparatus (FOSS Tecator AB, Hoganas, Sweden; procedure 920.39). The protein content was determined using a Kjeltec Auto 1030 Analyser (procedure 954.01). The ash content was determined according to procedure 920.153. Analysis of fibre components was performed according to Van Soest et al. (1991). The calcium and phosphorus contents were determined by inductively coupled plasma atomic emission spectrometry (ICP-EMS; Optima 8000, Perkin Elmer, U.S.A.).

The content of polysaccharides in HS was detected by phenol-sulphuric acid method. Preparation of standard glucose solution: accurately weigh 20 mg of anhydrous glucose dried at 105°C to constant weight, put it in a 250 mL volumetric flask, fix the volume and shake well for use. Drawing the standard curve: accurately absorb 0, 0.2, 0.4, 0.6, 0.8, 1.0 and 1.2 mL of glucose standard solution, put them in a test tube with a stopper, add water to 2 mL respectively, and shake well, then add 1.0 mL of 5% phenol solution, quickly add concentrated H₂SO₄ 5 mL, shake well and leave it at room temperature for 30 min until it is cooled. Then, use an ultraviolet spectrophotometer at 490 nm wavelength. Determination of polysaccharide content in the sample: the absorbance value is determined according to the above standard method, and the content is calculated according to the standard curve.

The content of flavonoids in HS was detected by colorimetry. Accurately weigh 1 g of raw materials, add 50% ethanol solution according to the ratio of material to liquid (1:20–1:40, g/ml), perform ultrasonic treatment for 2 h, centrifuge at 3000 r/min for 20 min and collect supernatant for determination. Taking rutin as standard, and mix 1.5 mL of extract with 1.5 mL of 2% AlCl₃-methanol solution (containing 5% acetic acid), stand for 10 min, and measure the absorbance at 430 nm. With rutin as the standard sample, a standard curve was established in the range of 10–500 μg/mL.

2.4.2. Growth performance

Body weights of each replicate rabbits were measured before feeding at the beginning and end of the trial, and the ADG was calculated from 42 to 98 days of age. The ADFI was calculated according to total feed intake divided by the total number of experimental days in each replicate. The F/G was then calculated as the feed intake/weight gain. The number of rabbits with diarrhoea or dead was recorded daily throughout the study.

2.4.3. Slaughter performance

As described by Blasco and Ouhayoun (1996), the slaughter procedure and carcass analysis were performed. Twelve hours before slaughter, rabbits were fasted and weighed, which was pre-slaughter body weight. After bleeding, the pelts, paws and full gastrointestinal tract were removed, and the commercial carcass was weighed (preserving the head, trachea, oesophagus, thoracic organs, liver, kidney and perirenal fat). The semi-clean carcass weight was commercial carcass weight removing the head at the first cervical vertebra, removing the trachea and oesophagus, retaining the liver, kidney and perirenal fat. The full-clean carcass weight is the semi-clean carcass weight removing the heart, liver, kidney and perirenal fat. At the same time, the thymus, spleen, heart, liver and kidney are weighed. At the same time, the commercial slaughter ratio, semi-clean slaughter ratio, full-clean slaughter ratio, thymus ratio, spleen ratio, heart ratio, liver ratio and kidney ratio were calculated by dividing the live weight before slaughter.

2.4.4. Morphological structure of small intestine

The ileum tissue samples were cut longitudinally at the mesenteric attachment and immediately fixed in 10% neutral formalin. The samples were then dehydrated in graded alcohols, cleared with xylene and embedded in paraffin. The serial microtome sections (5 µm thick) were stained with haematoxylin and eosin stain. In each slide, 10 well-oriented villi and crypts were analysed at a low magnification (40×) with a light microscope (using Image-Pro Plus 6.0 software, U.S.A.).

2.4.5. Immunoglobulins and cytokines levels

The ileum samples were disrupted and homogenized in PBS buffer (1 g samples: 9 ml PBS). After centrifuging with a speed of 5000 g for 10 min, the supernatant was isolated. The IgG, IgM and sIgA concentrations were measured with an immunoturbidimetry using Enzyme-Linked Immunosorbent Assay kits (CEA544Rb, CEA543Rb, SEA641Rb, respectively; Cloud-Clone Corp, Wuhan, China). The IgG, IgM and sIgA in supernatant could combine the IgG, IgM and sIgA antibody in 0.02 mol/L phosphate buffer substrate turnover was monitored spectrophotometrically at 450 nm with an automated reader (BioTek, Winooski, Vt.). The levels of IgA, TNFα, IFN-γ and IL-6 were determined using Enzyme-Linked Immunosorbent Assay kits (CSB-E06946Rb, CSB-E06998Rb, CSB-E06925Rb, CSB-E06903Rb, respectively; CUSABIO, Qingdao, China). After 1 h of incubation at 37°C, samples were removed and the plates were washed with a PBS buffer. After that, 100 μL horseradish peroxidase, and 100 μL of tetramethylbenzidine substrate was added to each well. The mixture was incubated in the dark for 30 min at room temperature. Optical density value at 450 nm was measured by a Bio-Rad ELISA reader (Bio-Rad, Richmond, CA).

2.4.6. RNA isolation and analysis

Total RNA Extraction Reagent Kit (RNAiso Plus, Takara, Code No. 9108/9109) was used to ileum RNA Isolation, and qRT-PCR by SYBR^® Premix Ex Taq™ II (Tli RNaseH Plus, Takara, Code No. RR820A) was performed as described previously (Liu et al. 2017). The PCR primers used in this study (Table 3) were designed using a Premier 5.0 Software and synthesized by Ruibo Biological Engineering Co., Ltd. (Qingdao, China). The relative mRNA expression levels were calculated using the arithmetic formula 2^−△△Ct (Livak and Schmittgen 2001).

Table 3. Gene-specific primers used for the analysis of rabbit gene expression.

Gene name	GeneBank	Primer sequences (5′–3′)	Product size, bp
GAPDH	NM_001082253	GTCAAGGCTGAGAACGGGAA	129
		GAAGACGCCAGTGGATTCCA
claudin1	NM_001089316	AAAGATGCGGATGGCTGTCA	187
		AAGGCAGAGAGAAGCAGCAG
Occludin	XM_008262318	TCGTTTGAGCAGCAGCAGTA	161
		ACTCCCTGATCCAGTCCTCC
ZO1	XM_017348357	AGAGGATTTGTCAGCCCAGC	179
		CTCGCGGTTCACTTTTTGCA
JAM3	XM_008248362	GAAGTCCTGGGGCAGACTTC	158
		CTGCAGACAGGGGTTACTGG
mucin1	XM_017345830	CACACCATCTTCGGTTCCCA	197
		ACTTGCTGCTTGGATCCTCC

GAPDH = glyceraldehyde 3-phosphate dehydrogenase; ZO1 = zonula occluden protein 1; JAM3 = junctional adhesion molecules 3.

2.5. Statistical analysis

All of the data collected were subjected to one-way ANOVA analysis with the Statistical Analysis Systems statistical software package (Version 8e, SAS Institute, Cary, NC), and the primary effect of HS treatments on the responses among the various groups, and Duncan’s test was used for multiple comparisons. Besides, the data are shown as the means and root mean errors (RMSE), P < .05 was statistically significant.

3. Results

3.1. Growth performance

The growth performance of the experimental rabbits is presented in Table 4. Dietary HS supplemental level had significant effect on ADFI, ADG, F/G, diarrhoea ratio and mortality ratio (P < .05) of meat rabbits, with the increase of addition level, the feed intake, F/G, diarrhoea ratio and mortality ratio decreased, and the FBW and ADG increased.

Table 4. Effects of Humulus scandens supplementation on growth performance and feed intake in rabbits.

Items	Levels of Humulus scandens, %				RMSE	P-value
	0 (Control)	4	8	12
IBW, g	876.5	886.8	887.0	892.7	57.2615	.9755
FBW, g	2313.0^b	2367.8^b	2495.3^a	2567.5^a	84.2817	.0008
ADG, g/d	25.65^c	26.45^bc	28.72^ab	29.91^a	1.9991	.0136
ADFI, g/d	100.54^ab	101.80^a	98.91^b	98.91^b	2.3075	.0201
F/G	4.13^a	3.96^ab	3.71^bc	3.40^c	0.2699	.0032
Diarrhoea ratio^1, %	12.50^a	7.50^ab	5.00^b	5.00^b	0.2245	.0209
Mortality ratio^2, %	7.50^a	5.00^ab	2.50^b	2.50^b	0.2058	.0490

¹ Diarrhea ratio (%) = 100 × (number of rabbits with diarrhoea × average diarrhoea days)/(number of experimental rabbits × experimental days).

² Mortality (%) = 100 × (number of rabbits with death/number of experimental rabbits).

^a,b,cDifferent superscript letters means different (p < .005).

RMSE, root mean square error; IBW, initial body weight; ADFI, average daily feed intake; ADG, average daily gain; F/G, feed to gain ratio.

3.2. Slaughter performance

Dietary HS supplemental level had significant effect on pre-slaughter body weight, commercial carcass weight, semi-clean carcass weight, full-clean carcass weight and kidney weight (P < .05) of experimental rabbits, the pre-slaughter body weight, commercial carcass weight, semi-clean carcass weight, full-clean carcass weight in the higher group (8% and 12% group) were higher than those of the control group. Besides, the kidney weight of the experimental group (4%, 8% and 12% group) with HS was significantly higher than those of the control group. Furthermore, HS supplemental of maternal diets had no influence on the heart weight, lung weight, liver weight or the commercial slaughter ratio, semi-clean carcass ratio, full-clean carcass ratio, heart index, lung index, liver index (P > .05; Table 5).

Table 5. Effects of Humulus scandens supplementation on carcass traits of rabbits.

Items	Levels of Humulus scandens, %				RMSE	P-value
	0 (Control)	4	8	12
Pre-slaughter body weight, g	2259.6^b	2379.0^ab	2473.0^a	2535.0^a	114.7642	.0089
Commercial carcass weight, g	1254.9^c	1331.5^bc	1396.7^ab	1488.0^a	82.7896	.0029
Semi-clean carcass weight, g	1109.5^c	1186.4^bc	1247.6^ab	1336.0^a	79.5357	.0027
Full-clean carcass weight, g	1023.0^c	1091.0^bc	1145.6^ab	1234.2^a	72.8901	.0024
Heart weight, g	5.93	5.97	6.49	6.20	0.3882	.1253
Lung weight, g	11.52	10.94	13.26	12.10	1.6660	.1932
Liver weight, g	65.33	71.22	75.33	78.65	8.2528	.1040
Kidney weight, g	12.09^b	14.16^a	14.58^a	14.42^a	1.0303	.0049
Commercial slaughter ratio, %	55.55	55.97	56.50	58.65	1.9648	.1003
Semi-clean slaughter ratio, %	49.12	49.85	50.46	52.65	1.9214	.0544
Full-clean slaughter ratio, %	45.31	45.86	46.35	48.64	1.9357	.0700
Heart ratio, g/kg	2.62	2.52	2.56	2.51	0.1762	.7443
Lung ratio, g/kg	5.10	4.61	5.24	4.90	0.7468	.5877
Liver ratio, g/kg	28.92	29.81	29.71	31.72	2.2454	.2770
Kidney ratio, g/kg	5.10	4.61	5.24	4.90	0.7468	.5877

RMSE, root mean square error.

3.3. Immune organ development

As shown in Table 6, dietary HS supplemental level had no significant effect on thymus weight, spleen weight or thymus ratio, spleen ratio (P > .05) of experimental rabbits.

Table 6. Effects of Humulus scandens supplementation on immune organ development of rabbits.

Items	Levels of Humulus scandens, %				RMSE	P-value
	0 (Control)	4	8	12
Thymus weight, g	4.55	4.72	4.82	4.80	0.8512	.9529
Thymus ratio, g/kg	1.91	1.94	2.01	1.99	0.3742	.9665
Spleen weight, g	1.16	1.28	1.09	1.05	0.2061	.3272
Spleen ratio, g/kg	0.51	0.54	0.43	0.42	0.0841	.0918

RMSE, root mean square error.

3.4. Morphological structure of small intestine

The HS supplementation in the diet did not alter the villus height, crypt depth, villus width, mucosal layer thickness and muscle layer thickness (P > .05) of the small intestine (Table 7).

Table 7. Effects of Humulus scandens supplementation on intestinal morphology of rabbits.

Items	Levels of Humulus scandens, %				RMSE	P-value
	0 (Control)	4	8	12
Villus height, µm	865.30	900.61	803.88	771.05	180.1309	.3533
Crypt depth, µm	147.45	169.63	179.81	167.53	35.6639	.5539
Villus width, µm	137.48	147.83	157.65	162.46	22.7420	.3466
Mucosal layer thickness, µm	1017.60	1143.90	1134.90	1228.70	199.0111	.4396
Muscle layer thickness, µm	104.29	117.45	106.16	124.46	22.8826	.4764

RMSE, root mean square error.

3.5. Immune active compounds

The HS supplementation in the diet could improve the titre of the IgG, IgA and sIgA (P < .05) in serum and intestinal (Table 8). However, the titre of the TNF-α, IFN-γ and IL-6 in serum and intestinal was decreased by HS supplementation level increased. Compared with the control, the HS supplementation in the diet did not alter the level of IgM (P > .05) in serum.

Table 8. Effects of Humulus scandens supplementation on immune active compounds of rabbits.

Items	Levels of Humulus scandens, %				RMSE	P-value
	0 (Control)	4	8	12
Immune active compounds in serum
IgG titre, μg/mL	7.53^b	8.01^a	8.25^a	8.32^a	0.4612	.0080
IgM titre, ng/mL	645.31	659.96	671.89	692.10	41.6420	.1695
IgA titre, ng/mL	114.20^c	121.13^b	127.57^ab	130.29^a	6.4129	.0001
sIgA titre, ng/mL	159.90^c	177.37^bc	209.08^a	190.05^ab	24.9001	.0041
TNF-α titre, ng/mL	3.28	3.00	3.17	2.99	0.4218	.4701
IFN-γ titre, pg/mL	362.07^a	352.68^a	328.26^a	237.77^b	66.8278	.0033
IL-6 titre, pg/mL	327.41^a	263.98^b	270.62^b	269.45^b	38.4523	.0079
Immune active compounds in intestinal
IgG titre, μg/g	14.10^b	23.80^a	21.68^a	25.54^a	6.4128	.0071
IgM titre, ng/g	21.82^c	34.31^b	43.25^a	50.71^a	8.0591	<.0001
IgA titre, ng/g	3.42^b	13.74^a	12.94^a	10.01^ab	7.1810	.0311
sIgA titre, ng/g	222.26^b	354.17^a	320.14^a	311.71^a	68.4362	.0046
TNF-α titre, ng/g	22.83^a	22.78^a	22.56^a	14.66^b	4.5753	.0023
IFN-γ titre, ng/g	73.48^a	70.05^a	68.57^a	59.64^b	7.4278	.0064
IL-6 titre, ng/g	1.74^a	1.47^ab	1.38^ab	1.27^b	0.3309	.0499

RMSE, root mean square error.

3.6. Gene expression of physical barrier

Agarose gel map for RNA quality was seen in Figure 1. The HS supplementation in the diet did not alter the mRNA expression of claudin1 and occludin (P > .05) in the small intestine (P > .05, Figure 2). Compared with the control, the HS supplementation groups for 12% level could decrease the mRNA expression of ZO-1, JAM3 and mucin1 (P < .05).

Figure 1. Agarose gel map for RNA quality. A, B, C and D represent Humulus scandens were supplemented at 0, 4%, 8% and 12%, 1–6 represent different samples of this group.

Figure 2. Effect of Humulus scandens on mRNA expression of physical barrier gene in ileum of rabbits. Values are presented as the means ± std. error (n = 6). * indicates P < .05, ** indicates P < .001, *** indicates P < .0001. A, B, C and D represent Humulus scandens were supplemented at 0, 4%, 8% and 12%.

4. Discussion

As we all know, HS often grows wild in ditches, wastelands, ruins and forest edges, which adapts to various environmental conditions and can be harvested in large quantities in the autumn mature stage. HS has been used to treat inflammatory diseases in China. Luteolin is one of the flavonoids isolated from HS, it is a common flavonoid, which exists in many herbal medicines. Plants rich in luteolin have been used in traditional Chinese medicine to treat inflammatory disorders diseases (Ziyan et al. 2007; Lin et al. 2008). The main constituent of HS is fibre (Table 1). In our study showed that in rabbits of similar initial body weight (Table 3), the inclusion of HS in the diet decreased the ADFI and F/G in rabbits between 42 and 98 days of age. This result may be due to the difference in energy level in the four diets by different level with HS powder. Accordingly, the levels of fibre and fibre proportions in diet decreased when dietary HS levels increased (Table 2). The degree of lignification is the main factor responsible for a reduction in digestibility of raw feed and feedstuffs (Gidenne and Perez 1994). The cell wall lignification is lower in higher HS level (12%group) than that in control groups (Table 2). Thus, the lower fibre level should explain the higher energy and protein in diets containing HS and the subsequent reduction in ADFI. Carcass weight is closely related to live weight before slaughter, the results of slaughter ratio for rabbits showing no or few effects of fibre sources inclusion, which was agree with the previous studies (Dal Bosco et al. 2012; Margüenda et al. 2012). Guo et al. (2008) reported that the mixture (50:50) of HS and alfalfa constitutes an alternative source of fibre for fattening rabbits and prevents diarrhoea effectively. In this study, we firstly investigate the addition effect of HS in rabbit production. After detecting the indicators of performance, intestinal morphology and intestinal barrier, the present study showed a positive effect of HS as rabbit feed resource.

The intestinal mucosal barrier is mainly composed of epithelial cells, tight junctions between adjacent enterocytes, and critical components of the mucosal immune system (Turner 2009). It acts as a selective barrier that allows the absorption and excretion of substances required for the homogenate state of the body and prevents the passage of various pathogens or their products. Under normal circumstances, epithelial cells allow only a small amount of intact antigens to enter the mucosa, where they interact with the mucosal immune system to reduce the inflammatory response. At the same time, intestinal pathogens can activate immune cells and initiate the inflammatory response required to eliminate infection (Chadwick et al. 2002). Under the condition of inflammatory bowel disease, the excessive penetration of antigen through the epithelial layer may lead to inappropriate immune stimulation and chronic gastrointestinal inflammation (Baumgart and Carding 2007). In addition, epithelial cells dilute, flush and bind harmful substances by secreting liquid and mucus and sIgA into the lumen, so as to play an important physiological defence role (Shang et al. 2008). sIgA is a major mucosal immune effector molecule, which provides an important first line of defence against pathogens (Woof and Kerr 2006). In line with the previous studies, rabbits after HS treatment increased the intestinal sIgA concentration. IgG is another important immunoglobulin, which can promote immune cells to phagocytize pathogens and neutralize bacterial toxins. In this study, the addition of HS to the diet increased the secretion of intestinal immunoglobulin in rabbits, which suggests HS treatment could increase the ability of immune cells to swallow pathogens and toxins.

Cytokines play an important role in the immune system and are also potential targets of immune regulation (Hill and Sarvetnick 2002). Some studies indicate that some herbs and plant extracts inhibit the synthesis of pro-inflammatory cytokines such as TNF-α and other cytokines related to inflammatory processes such as IFN-γ and IL6 (Pérez-Köhler et al. 2015). In our study, dietary addition of 12% HS decreased significantly the TNF-α, IFN-γ and IL6 concentration in ileum, which imply that the HS also had an inhibition in synthesis of cytokines, it is consistent with Aziz et al. (2018), the luteolin in HS could regulate pro-inflammatory mediators by reducing the synthesis of a variety of pro-inflammatory cytokines (Aziz et al. 2018).

Tight junctions are assembled from at least three transmembrane proteins, including occludin, claudin and junction adhesion molecule (JAM), which are anchored to the cytoskeleton through peripheral membrane proteins, such as zonula occluden protein 1 (ZO1), ZO2 and ZO3 (Bazzoni et al. 2000). Mucin is a major glycoprotein expressed on the surface of breast epithelial cells and plays an important role in maintaining mucus protective layer and resisting inflammation. The main determinant of intestinal barrier function is intercellular tight junction (Martìn-Padura et al. 1998). These tight junctions proteins interact with other intracellular plaque ZO1, ZO2 and ZO3 proteins in turn anchor the transmembrane proteins to the actin cytoskeleton (Gonzalez-Mariscal et al. 2003). The association of tight junctions proteins with the perijunctional actin cytoskeleton ring is vital for maintaining the tight junctions structure and function (Gonzalez-Mariscal et al. 2003). RT–PCR analysis of the small intestine showed that the HS addition affects the gene expression of ZO-1, indicating that there may be improvement of the intestinal barrier mechanism.

5. Conclusion

Dietary supplement of Humulus scandens modulated immune responses via increasing the secretion of IgA and IgG and improved intestinal barrier might by regulating ZO1, JAM3 and mucin1 genes expression, meanwhile inhibit the synthesis of cytokine. These maybe cause low death rate of weaned rabbits, so our experiment offered a positive evidence of Humulus scandens as rabbit feed resource.

Ethics statement

The experimental procedures were approved by the Shandong Academy of Agricultural Sciences Animal Care and Use Committee (SAAS-2020-03) and were conducted in accordance with the Guidelines for Experimental Animals established by the Ministry of Science and Technology (Beijing, China).

Acknowledgement

The author thanks the staff of Shandong Zhengyu Rabbit Industry Co., Ltd. for their excellent support during this experiment.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Additional information

Funding

This work was supported by Earmarked Fund for Modern Agro-industry Technology Research System (CARS-43-G-7); Shandong Province Modern Agricultural Industry Technology System (SDAIT-21); Scientific and Technological Problems Project Unveiled by Shandong Academy of Agricultural Sciences (SHJB2021-43).