Association of polymorphisms in exon 6 and 3′-untranslated region of the OLR1 gene with milk production traits in Sahiwal cattle

ABSTRACT

The present investigation was undertaken to explain the association of SNPs (single nucleotide polymorphisms) in exon 6 and 3′-UTR of OLR 1 gene with milk traits in Sahiwal cattle. Milk traits were observed from 328 Sahiwal cows sired by 64 bulls viz: – First lactation 305 days milk yield (Kg) (FL305MY), Average test day milk yield (Kg) (ATDMY), Average test day fat percentage (%) (ATDFP) and Lactational fat yield (Kg) (LFY). The animal model was used to estimate the breeding values for FL305MY and LFY. The traits ATDMY and ATDFP were corrected for significant non-genetic factors by using LSML-Harvey and subsequently used for association studies. A total of 130 animals for PCR-RFLP and 103 for sequencing were screened through three sets of primers for the presence of polymorphisms in exon 6 and 3′-UTR of the OLR1 gene. The CC genotype of SNP C337A in the 3′-UTR of OLR1 gene had a significant effect (p < 0.01) on ATDFP and LFY. Allele combination CGC had a positive effect (p < 0.05) on ATDFP. Identified SNP C337A and CCGGCC haplotype can be used as potential markers for improving milk yield and composition traits in Sahiwal cattle.

KEYWORDS:

• SNP
• PCR-RFLP
• exon 6
• OLR1 gene
• Sahiwal

Introduction

Sahiwal is one of the best dairy breeds of indigenous cattle with its breeding tract in the Montgomery district of Pakistan. In India Karan-Swiss and Frieswal strains have been developed by crossing Sahiwal breed with exotic breeds like Brown Swiss and Holstein-Frisian. Considering its elite performance for various donor traits, the National Agricultural Commission (1976) recommended improving the Sahiwal breed. Sahiwal is one of the few breeds, which FAO has undertaken improvement (FAO, 1983). The elite Sahiwal cattle is famous for its higher milk production, remarkable power of endurance in the hot climate of the tropics, resistance to tropical diseases, low maintenance cost and high feed conversion efficiency (Ilatsia et al., 2012). Improving the production potential of our native livestock is paramount to meeting the continued demand for dairy products, which in turn provide better economic sustainability, nutritional security and livelihood for marginal and small farmers of the region. Milk production traits in dairy cattle are influenced by many quantitative trait loci (QTLs) and environmental factors. For dairy cattle since Georges et al. (1995) reported a QTL mapping study on milk yield characteristics, more than 1350 QTL for traits related to milk production have been reported (https://www.animalgenome.org/cgi-bin/QTLdb/BT/index accessed on 1 October 2020; Kim et al., 2021). Identifying, detecting and validating major genes/QTLs are critical for improving milk production in dairy cattle breeding (Ogorevc et al., 2009).

One of the most important candidate genes is the oxidized low-density lipoprotein receptor 1 gene (OLR1) located on chromosome 3 in sheep and consists of 6 exons (Adopted from ncbi.nlm.nih.gov). Based on combined data from different cattle maps, the gene has been estimated to be located in the interval of 106–108 cM of the bovine chromosome 5 and it consists of six exons that encode a 270-amino acid protein (Khatib et al., 2006; Mohammed et al., 2021). The OLR1 gene codes for a vascular endothelial cell-surface receptor that binds to and degrades oxidized low-density lipoproteins (Metha and Li, 2002). Internalization of ox-LDL (oxidized-low density lipoprotein) triggers a chain of events that might contribute to endothelial dysfunction and atherosclerosis (Dunn et al., 2008). Oxidized lipids have also been reported to affect lipid metabolism and impair glucose metabolism in the liver and mammary glands (Ringseis et al., 2007; Liao et al., 2008). Several groups investigated and reported the effect of OLR1-related quantitative trait loci (QTL) on milk production characteristics (Olsen et al., 2002; Rodriguez-Zas et al., 2002; Viitala et al., 2003; Ashwell et al., 2004). OLR1 has been proposed as a potential candidate gene influencing milk production characteristics in dairy cattle due to its role in lipid metabolism and ox-LDL degradation (Khatib et al., 2006). It has been reported that SNP 8,232 in the 3′-UTR of exon 6 of the OLR1 gene is associated with milk fat yield and percentage (Khatib et al., 2006; Khatib et al., 2007; Schennink et al., 2009; Soltani-Ghombavan et al., 2013). Considering the above-reported associations and to provide a better estimation of the impact and size of the association of the OLR1 gene with production traits, there is a need to validate its genomic association with the first lactation traits, viz: – First lactation 305 days milk yield kg (FL305MY), Average test day milk yield kg (ATDMY), Average test day fat percentage % (ATDFP) and Lactation fat yield kg (LFY) in the Sahiwal cattle population. Consequently, this study was designed to detect the polymorphisms within the Bos Indicus OLR1 gene exon 6 and 3′-UTR region and their association with milk production traits in Sahiwal cattle.

Materials and methods

Experimental animals and type of feeding

The experimental animals for the present study were taken from the herd of Sahiwal cattle maintained at Livestock Research Centre (LRC), ICAR-National Dairy Research Institute, Karnal. One hundred thirty animals were used to screen for polymorphisms in exon 6 and 3′-UTR of the OLR1 gene. Only 103 samples were used for genotyping of animals by sequencing. The Sahiwal cows received green maize and wheat straw in the hot/humid season and berseem with green oat fodder in the winter season. The concentrate, which consisted of 20% CP and 70% TDN was fed 1.5 kg/day/Sahiwal for body maintenance. The dry pregnant cows were provided additional concentrate 1.5 kg/cow before 21 days of the expected calving date, and milking cows were provided additional concentrate 1 kg/3 kg milk production. The concentrate mixture consisted of 33% maize, 21% ground nut cake, 12% mustered cake, 20% wheat bran, 11% de-oiled rice bran, 2% mineral mixture and 1% common salt. The concentrate mixture was given as per National Research Council (2001) recommendations.

Phenotype data

The phenotypic data on diverse milk attributes in the present investigation has been generated from the first lactation production records of 328 Sahiwal cows sired by 64 bulls collected from Record Cell, Animal Genetics and Breeding Division of ICAR-National Dairy Research Institute, Karnal.

Milk sampling and analysis

Milk samples for milk composition analysis were recorded as first lactation 305 days milk yield at an interval of 6th, 35th, 65th, 95th, 125th, 155th, 215th, 245th and 275th days of lactation. Samples were collected from 3 consecutive milkings (morning, noon, and evening) mixed in proportion to obtain a composite sample. The milk fat% was estimated using a Mega Lactoscan analyzer. The milk samples were maintained at 28-32°C at the time of analysis, which is the calibration temperature of the analyzer. Records of animals with a lactation length of less than 100 days and milk production in a lactation of less than 500 kg were excluded from the study.

Traits

The data on the following parameters were recorded and used for the generation of the traits viz.

1. Age at first calving (days) - AFC

2. First lactation 305 days milk yield(kg) – FL305MY

3. Average test day milk yield (Kg) - ATDMY

4. Average test day fat percentage (%) - ATDFP

5. Average test day fat yield (kg) - ATDFY

6. Lactation fat yield (kg) - LFY

   1. Average test day milk yield (kg):

   2. Average test day fat percentage (%): $\mathrm{ATDFP}={\displaystyle \frac{T{D}_{1}F\text{\%}+T{D}_{2}F\text{\%}+\dots +T{D}_{N}F\text{\%}}{\mathrm{No}.\mathrm{ofTestDays}}}$

   3. Average test day fat yield (kg) $\begin{array}{rl}\mathrm{ATDFY}={\displaystyle \left(T{D}_1\mathrm{MY}\times T{D}_{1}F\text{\%}\right)+\left(T{D}_2\mathrm{MY}\times T{D}_{2}F\text{\%}\right)}& \\ \frac{+\dots +\left(T{D}_N\mathrm{MY}\times T{D}_{N}F\text{\%}\right)}{T{D}_1\mathrm{MY}+T{D}_2\mathrm{MY}+\dots +T{D}_N\mathrm{MY}}\end{array}$

   4. Lactation fat yield (kg) $\mathrm{LFY}=\mathrm{ATDFY}\times \mathrm{LactationLength}$

Classification of data

The data were classified into nine periods of calving, four seasons of calving (Winter, Summer, Rainy and Autumn) based on the type of feed and fodder availability on the farm and prevailing climatic conditions in the region as recorded in ICAR-CSSRI, Karnal (Singh, 1983) and three age groups based on age at first calving (days) AFC, viz:- ≤ 1020, 1021-1110, 1111–1200 and ≥1200 based on Sturges rule (Sturges, 1926).

Molecular analysis

Genomic DNA preparation

As described by Sambrook and Russell (2001), the phenol–chloroform method was used to isolate DNA from samples with minor modifications (extra washing step using ethanol and DNA is stored in milliQ water). Ten ml of venous blood was collected from the jugular vein of each milch animal under sterile conditions in a 15 ml polypropylene centrifuge tube containing 0.5 ml of 0.5 M EDTA solution after obtaining permission from the Institute Animal Ethics Committee. The tubes were kept in the refrigerator at – 20°C until DNA isolation was completed. The overall yield of DNA in Sahiwal cattle ranged from 350 - 510 μg with a mean of 414.64 ± 4.87 μg/ml and the overall purity of DNA (OD260/280) ranged from 1.70 - 1.90 with a mean of 1.80 ± 0.01.

PCR amplification and RFLP analysis

Primer designing

A detailed sequence of primers used in the present study and their characteristic nucleotide numbers, annealing temperatures/time, and amplicon size are presented in Table 1. PCR reaction was performed in a final volume of 25 μl containing 100 ng of template DNA, 10 pmol of each primer, 10X PCR buffer (20 mM Tris-HCL pH 8.4, 50 mM KCl), 1 mM MgCl₂, 2.0 mM of dNTPs and 1 μl of Taq DNA polymerase (M/s Genetix Biotech Asia Pvt. Ltd). This solution was initially denatured at 95°C for 5 min, followed by 35 cycles of denaturation (95°C for 1 min), annealing (55.1, 59.3 and 58.7°C for 30 secs), elongation (72°C for 1 min), and a final extension at 72°C for 5 min. The amplified products were detected in 1.5% Agarose gel electrophoresis, and the resolutions visualized in the gel are depicted in Figure 1. About 10 μl of amplified product was digested with 10 units of pst I enzyme ‘for 14 h’ at 37°C in a water bath. The digested products were detected by electrophoresis in 2% Agarose gel in 1X TBE buffer and ethidium bromide (10 mg/μl)(Al-Thuwaini, 2020).

Figure 1. Resolution of PCR products of OLR1 gene.

Table 1. Sequence of the primers designed, Annealing temperature and time for amplification of exon 6 OLR1 gene in Sahiwal cattle.

Primer set	Sequence (5′−3′)		No of base pairs	Annealing temperature (^0C) at 30s	Amplicon size (bp)
Exon 6,1	F	TATCCTTCAGGGACCTGTGC	20	55.1	582
	R	CAGCAAATGTTGCAAAAACAA	21
Exon 6,2	F	TGGCACCTTGATAGCAAAAG	20	59.3	579
	R	TGGACAAGCCAATTTAAGACAG	22
Exon 6,3	F	TGGCTTACAACATCACCATGA	21	58.7	611
	R	TGAAATCAGGCAAGGGAAAG	20

DNA sequencing and protein sequence analysis

PCR-RFLP by Pst1 restriction enzyme was used for genotyping of animals by Primer 1 using (Fermentas). Custom sequencing was performed on both ends (5’ and 3′) of amplified PCR products for Primers 2 and 3. BioEdit software (URL: http://www.mbio.ncsu.edu/BioEdit/bioedit.html.) was used to visualize and edit nucleotide sequences. ClustalW software (URL: http://www.ebi.ac.uk/Tools/msa/clustalo/) was used to identify SNPs by performing multiple sequence alignments of the edited sequence with corresponding reference sequences (Al-Thuwaini, 2021). The ExPASy Translate tool was used to convert nucleotide sequences to amino acids, edited and aligned with the reference OLR1 protein sequence of Bos taurus (Gasteiger et al., 2003). SIFT software (http://sift-dna.org) was used to examine amino acid substitutions (Sim et al., 2012).

Statistical analysis

Non-genetic factors

The normalized production traits were adjusted for significant non-genetic factors by least-squares analysis using the following model (Harvey, 1990). The model used was Y_ijkl= µ + P_i + S_j + (AG)_k + e_ijkl.

where, Y_ijkl= Observation on l^thcow in k^thage group of first calving, calved in j^thseason and i^thperiod of calving, μ = Overall mean, P_i= Fixed effect of i^th period of calving (1–9), S_j = Fixed effect of j^th season of calving (1–4), (AG)_k= Fixed effect of k^th age group of animals at first calving (1–4) and e_ijkl = Random error ∼ NID (0, σ²_e). The difference of means between any two subclasses of period, season, and age group was tested for significance using Duncan's Multiple Range Test (DMRT) as modified by Kramer (1957).

Breeding value

The single trait animal model was adopted for estimation of breeding values through WOMBAT software (Meyer, 2007) with the following observed model parameterization: ${\mathrm{Y}}_{\mathrm{ijk}}=\mathrm{X}{\mathrm{b}}_{\mathrm{i}}+\mathrm{Z}{\mathrm{u}}_{\mathrm{i}}+{\mathrm{e}}_{\mathrm{ijk}}$where, ${\mathrm{Y}}_{\mathrm{ijk}}$ = k^th observation of j^th random effect and i^th fixed effect, ${\mathrm{b}}_{\mathrm{i}}$ =  Vector of observation of fixed effects (period of calving, season of calving & age groups (AFC)), ${\mathrm{u}}_{\mathrm{i}}$ = Vector of additive genetic effect (Random animal effect), $\mathrm{X}$ = Design matrix/ Incidence matrix of fixed effect, $\mathrm{Z}$ = Design matrix/ Incidence matrix of random effect and ${\mathrm{e}}_{\mathrm{ijk}}$ = Vector of residual errors with E (y) = Xb.

Association studies

General Linear Model as described in R package was used to determine the effect of genotype on the individual trait. Y_ij  = µ +G_i+ e_ij, where, Y_ij= Breeding value/Least square means of j^th trait of i^thgenotype, µ = Overall mean, G_i= Fixed effect of i^th genotype of SNPs/Haplotype and e_ijk= Random error ∼ NID (0, σ²_e). The population was in Hardy Weinberg equilibrium for allele and genotype frequencies as analyzed by Chi-square test using Popgene software (Yeh et al., 1999). The allele substitution effect at each SNP was estimated using the following linear regression model in R software. Y_ij  = µ + βxi + e_ij, where, Y_ij= Breeding value/Least square means of j^th trait of i^th SNP/Haplotype, µ = Overall mean, β =  is the regression coefficient representing half of the allele substitution effect (α/2), xi is the effect of i^th SNP/Haplotype and e_ijk= Random error ∼ NID (0, σ²_e).

Results

Average of the traits

The average first lactation 305 days or less milk yield, Average test day milk yield, Average test day fat percentage and Lactational fat yield were estimated as 1816.56 ± 40.79 kg, 6.61 ± 0.11 kg, 4.76 ± 0.02% and 84.68 ± 2.00 kg with the coefficient of variation as 29.50%, 37.98%, 4.99% and 39.81% respectively. The period of calving had a significant effect (p < 0.01) whereas, Season of calving and age group at first calving had no significant on FL305MY, ATDMY, ATDFP and LFY.

Clustal W and sequencing

Comparative analysis about nucleotide sequences of exon 6 region of the Sahiwal cattle of OLR1 gene with that of the reference sequence of Bos taurus by ClustalW2 multiple alignments tool revealed a total of 8 mutations that include 5 transitions and 3 transversions. The base configuration of 8 SNPs was found at positions T96C, C155T, A165G, G179A, C265T, T294G, and G392T (Primer 2) C337A (Primer 1) as compared to Bos taurus (Ref. Seq. ENSBTAG00000004547) (Table 2). Primer 3 revealed a monomorphic pattern. These polymorphic positions are depicted by representative chromatograms exhibiting base change as compared to the reference sequence of the OLR1 gene in Bos taurus (Figures 2–8). The coding sequences were translated into amino acid sequences by using the ExPAsy translation tool and then subsequent multiple sequence alignment was performed with the corresponding Bos taurus sequence which revealed no amino acid change. The genotypic and allelic frequencies of the polymorphic loci are presented in Table 3.

Figure 2. Chromatogram and clustalw alignment showing variation at position 96 by primer 2 (T > C) of OLR1 gene in Sahiwal cattle.

Figure 3. Chromatogram and clustalw alignment showing variation at position 155 by primer 2 (C > T) of OLR1 gene in Sahiwal cattle.

Figure 4. Chromatogram and clustalw alignment showing variation at position 165 by primer 2 (A > G) of OLR1 gene in Sahiwal cattle.

Figure 5. Chromatogram and clustalw alignment showing variation at position 179 by primer 2 (G > A) of OLR1 gene in Sahiwal cattle.

Figure 6. Chromatogram and clustalw alignment showing variation at position 265 by primer 2 (C > T) of OLR1 gene in Sahiwal cattle.

Figure 7. Chromatogram and clustalw alignment showing variation at position 294 by primer 2 (T > G) of OLR1 gene in Sahiwal cattle.

Figure 8. Chromatogram and clustalw alignment showing variation at position 392 by primer 2 (G > T) of OLR1 gene in Sahiwal cattle.

Table 2. Summary of nucleotide changes in OLR1 gene in Sahiwal cattle as compared to Bos taurus (Ensembl Gene ID ENSBTAG00000004547).

Primer	Locus in PCR fragment	Genomic Position (bp) based on ARS-UCD 1.2 reference genome	Gene Region	Bos Taurus	Sahiwal	Type of Variation
Primer 1	337	99814316	Exon – 6 (3′-UTR)	C	A	Transversion
Primer 2	96	99814343		T	C	Transition
	155	99814402		C	T	Transition
	165	99814412		A	G	Transition
	179	99814426		G	A	Transition
	265	99814512		C	T	Transition
	294	99814541		T	G	Transversion
	392	99814639		G	T	Transversion

OLR1 = oxidized low-density lipoprotein receptor 1; PCR = Polymerase chain reaction

Table 3. Genotypic and allelic frequencies of OLR1 gene using sequencing and PCR – RFLP in Sahiwal cattle.

Gene	Exon 6 of OLR1 gene (3′-UTR)					Ne*	I*	Chi-Square (p-value)
Locus	Frequency
	Genotype			Allele
P1 337 C > A	AA	AC	CC	A	C	1.172	0.278	0.53
	0.03(4)	0.29(38)	0.68(88)	0.175	0.825
P2 96 T > C	CC	CT	TT	C	T	1.318	0.406	0.94
	0.73(75)	0.25(26)	0.02(2)	0.86	0.14
P2 155 C > T	CC	CT	TT	T	C	1.566	0.547	0.51
	0.07(7)	0.33(34)	0.60(62)	0.765	0.235
P2 165 A > G	AA	AG	GG	G	A	1.854	0.653	0.89
	0.12(12)	0.47(49)	0.41(42)	0.645	0.355
P2 179 G > A	AA	AG	GG	A	G	1.566	0.547	0.51
	0.60(62)	0.33(34)	0.07(7)	0.765	0.235
P2 265 C > T	CC	CT	TT	T	C	1.566	0.547	0.51
	0.07(7)	0.33(34)	0.60(62)	0.765	0.235
P2 294 T > G	GT	TT		G	T	1.275	0.373	0.31
	0.25(26)	0.75(77)		0.125	0.875
P2 392 G > T	GG	GT		T	G	1.111	0.206	0.70
	0.89(92)	0.11(11)		0.055	0.945

OLR1 = oxidized low-density lipoprotein receptor 1; PCR-RFLP = Polymerase chain reaction-Restriction fragment length polymorphism; UTR = Untranslated region; Ne* = Effective No. of alleles; I* = Shannon's Information Index

PCR-RFLP analysis of exon 6 amplified by primer 1 was carried out using the Pst1 restriction enzyme. Pst1-RFLP for exon 6 revealed three polymorphic patterns, AA (582 bp), AC (582 , 337 and 245 bp) and CC (337 and 245 bp) (Figure 9). Genotypic frequencies of AA, AC, and CC were 0.03, 0.29, and 0.68 respectively. The allelic frequencies for A and C were 0.175 and 0.825, respectively. Post-Hoc Tukey's association testing for the difference of means among the genotypes concerning polymorphic loci revealed that P1 337(C < A) had a highly significant effect on ATDFP (p < 0.01). Genotypes of other polymorphic loci (Table 4) revealed a significant effect on this trait at (p < 0.05) level of significance which includes P2-96, P2-155, P2-165, P2-179 and P2-265. However other identified mutational changes exhibited no significance on this trait. Similarly, the P1-337 locus significantly affected the LYF trait (p < 0.01). All other polymorphic loci revealed no significant or positive effect on the LYF trait. The population under study was in Hardy-Weinberg equilibrium.

Figure 9. PCR-RFLP pattern at loci 337(C > A) of OLR1 gene amplified by Primer 1 and digested by pst1 enzyme.

Table 4. Effect of polymorphism of OLR1 gene on average test day milk yield/ fat percentage and breeding value for the first lactation 305 days milk yield and lactational fat yield in different genotypes.

Gene	OLR1 gene
SNP/Loci Name	Genotype	ATDMY	ATDFP	FL305MY	LFY
C337A	AA	6.843 ± 1.079	4.624^b ± 0.042	1829.737± 28.332	89.788^b± 1.550
	AC	7.013 ± 0.360	4.716^b ± 0.047	1901.538± 39.444	92.074^b± 1.850
	CC	7.157 ± 0.234	4.987^a ± 0.031	2013.351± 25.620	100.554^a± 1.202
	P-value	0.486	0.001	0.824	0.001
T96C	CC	7.193 ± 0.319	4.800^b ± 0.044	1921.131 ± 35.140	93.636 ± 1.702
	CT	6.864 ± 0.513	4.996^a ± 0.070	1810.990 ± 56.472	91.660 ± 2.735
	TT	4.225 ± 1.324	4.570^b ± 0.081	1648.538 ± 35.809	79.357 ± 3.062
	P-value	0.100	0.025	0.078	0.146
C155T	CC	6.780 ± 1.081	5.000^a± 0.048	1797.198 ± 59.053	92.506 ± 2.766
	CT	6.843 ± 0.466	4.925^b ± 0.064	1837.454 ± 51.336	91.381 ± 2.486
	TT	5.517 ± 0.665	4.609^b ± 0.091	1786.739 ± 73.272	85.241 ± 3.549
	P-value	0.260	0.014	0.837	0.330
A165G	AA	7.228 ± 0.806	4.974^a ± 0.010	1822.679 ± 38.737	92.530 ± 2.298
	AG	6.477 ± 0.405	4.906^b ± 0.055	1828.049 ± 44.622	90.926 ± 2.161
	GG	4.946 ± 0.957	4.490^b ± 0.031	1762.098 ± 35.420	82.486 ± 2.106
	P-value	0.194	0.012	0.847	0.270
G179A	AA	5.517 ± 0.665	4.609^b ± 0.091	1786.739 ± 73.272	85.241 ± 3.549
	AG	6.843 ± 0.466	4.925^b± 0.064	1837.454 ± 51.336	91.381 ± 2.486
	GG	6.780 ± 1.081	5.000^a ± 0.048	1797.198 ± 41.053	92.506 ± 2.766
	P-value	0.260	0.014	0.837	0.330
C265T	CC	6.780 ± 1.081	5.000^a ± 0.048	1797.198 ± 59.053	92.506 ± 1.766
	CT	6.843 ± 0.466	4.925^b ± 0.064	1837.454 ± 51.336	91.381 ± 2.486
	TT	5.517 ± 0.665	4.609^b ± 0.091	1786.739 ± 73.272	85.241 ± 3.549
	P-value	0.260	0.014	0.837	0.330
T294G	GT	7.391 ± 0.610	4.885 ± 0.083	1854.831 ± 67.155	91.664 ± 3.253
	TT	6.100 ± 0.466	4.822 ± 0.064	1799.253 ± 51.337	88.991 ± 2.486
	P-value	0.099	0.551	0.514	0.517
G392T	GG	6.345 ± 0.402	4.824 ± 0.055	1807.879 ± 44.298	88.963 ± 2.146
	GT	6.534 ± 1.026	4.881 ± 0.040	1824.639 ± 42.943	91.761 ± 3.470
	P-value	0.865	0.705	0.891	0.636

^a,b Significant differences in means represent by differences in the same column within each classification, the p value with statistical significance are indicated in bold numbers.

OLR1 = oxidized low-density lipoprotein receptor 1; SNP = Single nucleotide polymorphism; ATDMY = Average test day milk yield; ATDFP = Average test day fat percentage; FL305MY = First lactation 305 days milk yield; LFY = Lactational fat yield

Seven SNPs and 1 RFLP marker were evaluated for the linkage disequilibrium test under haploview software. This analysis revealed two types of allele combinations CGC and TAT in the Sahiwal cattle population. The CCGGCC haplotype had a significant influence on ATDFP (Table 5). Haplotype inferences were taken from homozygous genotypes only as alleles in the heterozygous genotypes could not be traced back to the respective sire and dam families. The haplotype frequencies of the OLR1 gene are presented in (Table 6).

Table 5. Effect of haplotypes of OLR1 gene on average test day milk yield/ fat percentage and breeding value for the first lactation 305 days milk yield and lactational fat yield in different genotypes.

Gene	OLR1 gene
SNP Locus Combination/Haplotypes C155T, G179A, C265T	Allele Combination	ATDMY	ATDFP	FL305MY	LFY
CCGGCC CTGACT TTAATT	CGC	7.200 ± 0.443	5.050^a± 0.023	1820.436 ± 38.437	94.183 ± 1.957
	TAT	7.004 ± 0.323	4.759^b± 0.042	1919.268 ± 33.764	93.144 ± 1.700
	p-value	0.846	0.032	0.349	0.844

^a,b Significant differences in means represent by differences in the same column within each classification, the p value with statistical significance are indicated in bold numbers.

Table 6. Allele frequencies of OLR1 gene in Sahiwal cattle.

SNP Locus Combination/Haplotypes	OLR1 gene
	Allele Combination Frequency
C155T, G179A, C265T	CGC	TAT
	0.1(7)	0.9(63)

Discussion

Post-Hoc Tukey's association testing for identified SNPs concerning different polymorphic loci of the OLR1 gene is presented in Table 4. The general observations revealed that fewer SNPs had a positive and highly significant effect on the milk attributes. Khatib et al. (2006), Komisarek & Dorynek (2009), Wang et al. (2012), and SoltaniGhombavani et al. (2013) reported frequencies of 0.46, 0.43, 0.42, and 0.157 respectively for the A allele and 0.54, 0.57, 0.58, and 0.483 for the C allele, in the American-Polish, Czech Fleckvieh, Israeli Holstein and Iranian HF population. Our study showed a higher frequency of 0.825 for allele C and a lower frequency of 0.175 for allele A, consistent with Schennink et al. (2009), who reported a frequency of 0.29 and 0.71 for alleles A and C in the Dutch Holstein population.

The genotype frequencies of AA, AC, and CC were found to be 0.03, 0.29, and 0.68, respectively, with the CC genotype being the most abundant. In the Israeli and Iranian Holstein populations, Wang et al. (2012) and Soltani-Ghombavani et al. (2013) found genotype frequencies of 13, 58, 29 percent and 28.9, 45.6, 25.5 percent for AA, AC, and CC, respectively. Komisarek and Dorynek (2009) found the most common variant to be AC (51.66 percent) in Polish Holsteins, whereas Schennink et al. (2009) found the most common genotype to be CC in the Dutch Holstein population.

The SNP C337A corresponded to three genotypes among which the CC genotype had a positive effect (p < 0.01) on ATDFP and was consistent with Khatib et al. (2006) in North American Holstein cattle, Soltani-Ghombavani et al. (2013) in Iranian HF, Komisarek, and Dorvnek (2009) in HF polish bulls, Schennink et al. (2009) in Dutch HF, Mashhadi et al. (2014) in Iranian HF. Ates et al. (2014) reported a significant effect of g.223 C > A, g.8232 C > A, allele C and g.8232 C > A on fat percentage in Turkey cow SAR and EAR. Association of SNP C337A with LFY(p < 0.01) was inconsistent with Khatib et al. (2006) in North American Holstein cattle. In contrast, Komisarek and Dorynek (2009) and Schennink et al. (2009) did not find any association in their studies. Ardicli et al. (2018) and Rychtarova et al. (2014) observed no association between marker C223A and milk yield or composition traits in the Czech Fleckvieh and Holstein-Fresian cows, respectively. The genotypes corresponding to SNPs T96C, C155T, A165G, G179A, and C265T in the 3′-UTR region of exon-6 of the OLR1 gene had a significant effect (p < 0.05) on ATDFP. Milk production and composition traits in Sahiwal cattle were unaffected by genotypes at the remaining locus. In the Sahiwal population, the haplotype CGC had a significant (p < 0.05) influence on the average test day fat percentage (Table 5). The CCGGCC haplotype had a mean of 5.05 ± 0.12 for ATDFP with a frequency of 10% in the population, whereas the TTAATT haplotype had a frequency of 90% (Figure 10). Khatib et al. (2006) identified 4 intragenic haplotypes with haplotype 2 associated with a significant increase in fat yield and percentage in the cooperative dairy DNA repository (CDDR) Holstein population. The allele substitution effect of OLR1 variants on the milk traits was in conformity with the genotypic effects, further validating our findings (Table 7). The allele substitution effect at locus C337A was positive and significant on ATDFP by 0.030%, LFY by 2.275%, with a decrease of – 0.007% in ATDMY. Allele substitution effect at T96C had a negative effect on ATDFP by – 0.170% whereas at loci C155T, A165G and G179A had a positive and significant effects by 0.238%, 0.142% and 0.138%.

Figure 10. Linkage disequilibrium blocks with LD values (R-squared) along with corresponding haplotypes of OLR1 gene.

Table 7. Estimates of the allele substitution effect of OLR1 SNPs and Haplotypes.

Gene	OLR1 gene
SNP/Loci Name	Allele Substitution effects	ATDMY	ATDFP	FL305MY	LFY
C337A	α/2 ±SE	0.007 ± 0.031	0.030 ± 0.004	82.80 ± 29.59	2.275 ± 0.8
	p-value	0.261	0.001**	0.060	0.032*
T96C	α/2 ±SE	0.001 ± 0.041	−0.170 ± 0.071	97.87 ± 17.89	1.592 ± 0.797
	p-value	0.583	0.020*	0.301	0.676
C155T	α/2 ±SE	0.077 ± 0.023	0.238 ± 0.055	47.83 ± 23.85	−0.031 ± 0.187
	p-value	0.865	0.010*	0.095	0.301
A165G	α/2 ±SE	0.032 ± 0.095	0.142 ± 0.050	70.71 ± 12.14	1.007 ± 0.037
	p-value	0.942	0.060	0.098	0.080
G179A	α/2 ±SE	0.053 ± 0.123	0.138 ± 0.055	47.83 ± 25.85	−0.031 ± 0.187
	p-value	0.863	0.010*	0.132	0.463
C265T	α/2 ±SE	−0.077 ± 0.065	−0.008 ± 0.005	36.83 ± 17.85	−0.001 ± 0.187
	p-value	0.719	0.010*	0.127	0.091
T294G	α/2 ±SE	−0.084 ± 0.013	−0.053 ± 0.004	−70.20 ± 26.48	−2.500 ± 0.154
	p-value	0.900	0.070	0.218	0.132
G392T	α/2 ±SE	−0.117 ± 0.061	−0.050 ± 0.018	−25.84 ± 14.12	0.524 ± 0.449
	p-value	0.890	0.090	0.783	0.139
Haplotypes
Haplotypes	α/2 ±SE	−0.024 ± 0.023	0.038 ± 0.035	69.83 ± 15.85	−0.031 ± 0.187
	p-value	0.081	0.001**	0.160	0.151

α/2 is the regression coefficients for the OLR1 alleles and haplotypes; *p < 0.05; **p < 0.01; ***p < 0.001

The relationship between the C allele and increased milk fat may be due to linkage disequilibrium with a functional polymorphism site in the OLR1 gene or another closely related gene that influences OLR1 expression. This is supported by the fact that OLR1 expression was more significant in CC cows than in AA cows (Khatib et al. 2006). OLR1 removes ox-LDL from the circulation, thereby decreasing its negative effects on insulin production and signalling. The involvement of insulin in modulating lipoprotein lipase activity and mRNA in the mammary glands of nursing mice has been found (Jensen et al. 1994). Iverson et al. (1995) reported a link between lipoprotein lipase activity and high milk fat during lactation in grey seals. Such a link might exist in the bovine mammary gland. Oxidized fat inhibited gene expression of lipoprotein lipase and fatty acid transporters in the mammary glands of rats, resulting in low milk triacylglycerol concentrations (Ringseis et al. 2007). As an oxidized fat, ox-LDL may decrease milk fat in the same way in the bovine mammary gland. More OLR1 gene expression and elimination of ox-LDL from the blood can explain the link between the C allele and more significant milk fat.

Conclusion

Milk and its products are the most important nutritional resource in meeting energy requirements, offering high-quality protein and various vitamins and minerals. Detecting genetic variants and their association with milk traits are essential for a better understanding of quantitative traits and genetic improvement of Sahiwal cattle for improved production and productivity. The present results confirmed previous investigations of SNP 8,232 in the 3′-UTR of exon 6 in the OLR1 gene. This work also found that other locis T96C, C155T, A165G, G179A, and C265T in the 3′-UTR region of exon 6 influenced ATDFP. The effects of allele substitution further validated our findings.

Moreover, we performed a linkage disequilibrium analysis resulting in a significant association of CCGGCC haplotype with average test day fat percentage. The association results reveal important information with potential in selection programmes for dairy cattle through Marker Assisted Selection. Further investigations are needed to confirm or refute the results and find mechanisms underlying the association found in this study.

Acknowledgments

The authors are indebted to the Director and Vice-Chancellor, ICAR-NDRI, Karnal, Haryana for providing the infrastructure facilities that enabled the successful completion of the project.

Disclosure statement

No potential conflict of interest was reported by the author(s).