Effects of dietary forage-to-concentrate ratio on fat deposition, fatty acid composition, oxidative stability and mRNA expression of sirtuins genes of subcutaneous fat in sheep (Ovis aries)

ABSTRACT

This study was carried out to evaluate the effects of dietary concentrate: forage (C: F) ratio on fat deposition, fatty acid composition, oxidative stability and mRNA expression levels of sirtuins genes associated with adipose tissue metabolism of subcutaneous fat in Black Tibetan sheep. Three diets with different C: F (HC: 70:30, IC:50:50 and LC: 30:70) were fed to fifteen weaned male lambs (2-month-old, 10.05 ± 0.96 Kg). The experiment lasted for 120 d. Five lambs from each group were randomly selected and slaughtered at the end of the experiment. The subcutaneous fat thicknesses increased with increasing concentrate level (P < 0.05). The concentration of polyunsaturated fatty acid (PUFA), C15:1 and C18:2n decreased by feeding the HC diet (P < 0.05). Both glutathione peroxidase (GSH-Px) and superoxide dismutase (SOD) activities significantly increased as dietary concentration levels decreased (P < 0.05). Additionally, SIRT1 and SIRT2 expression level was downregulated (P < 0.05) with increasing concentration supplementation (P < 0.05 and P < 0.05, respectively). In conclusion, the addition of 70% concentration supplementation is not recommended in Black Tibetan sheep, considering that no benefits were observed for nutrient utilization, oxidative stability or economic returns, while the supplementation of C: F at 50:50 proved to be suitable for finishing lambs.

KEYWORDS:

• Black Tibetan sheep
• forage-to-concentrate ratio
• fat deposition
• fatty acid composition
• gene expression

1. Introduction

Adipose tissue was considered the primary energy depot organ from which free fatty acids can be released to meet systemic energy needs (Contreras et al. 2017). More recently, adipose tissue was recognized as an tive endocrine organ which maintained normal physiological functions including metabolism, appetite, inflammation, immunity and reproduction (Kusminski et al. 2016), thereby regulating whole-body homeostasis (Greco and Mallio 2021). Mammalian adipose tissue is divided into visceral, subcutaneous, intermuscular and intramuscular (Gui et al. 2017), exhibiting distinct molecular, biological and anatomical characteristics (Jeon et al. 2021). Despite the restrain of intramuscular fat deposition by excessive subcutaneous fat, the subcutaneous fat is believed to play immunologically defencive and mechanically protective roles in livestock (Duffaut et al. 2009). Therefore, increased knowledge of how fat deposition is affected by nutrition in ruminants may contribute to the development of feeding strategies to improve health and meat quality.

Due to the extremely harsh environment, feed availability was seriously deficient during the cold season (Zhou et al. 2018), resulting in hypoimmunity, hypofunction and growth retardation of Tibetan sheep (Hu et al. 2019). It was evident that high-energy feedstuffs contributed to nutrient requirements and improved the cost efficiency in ruminants (Kumari et al. 2012). However, excessive concentrate diets caused rapid accumulation of the fermentation end products accompanied by a decrease in pH, consequently, inducing subacute ruminal acidosis, fatty liver and laminitis (Jia et al. 2014). In addition, neutral detergent fibre (NDF) in roughage was the pivotal index for the nutritional evaluation, which promoted the morphological and functional development of the gastrointestinal tract and the health of the organism (Quigley et al. 2018). Based on those literature studies, it can be summarized that scientific concentrate supplementation may overcome nutritional problems and improve the economic value and health status of ruminants.

Sirtuins were NAD⁺-dependent histone/protein deacetylases consisting of seven subtypes that were placed in the nucleus (SIRT1, 6 and 7), cytoplasm (SIRT2) and mitochondria (SIRT3, 4 and 5), controlling important cellular and physiological processes in a mammal (Fiorino et al. 2014). Despite diverse subcellular localizations and a broad range of substrate specificities, sirtuins-modulated lipogenesis and adipogenesis through direct deacetylation of transcription factors (Al-Khaldi and Sultan 2019). So far, a few relevant reports on sirtuins have been published in the breeding and reproduction of Black Tibetan sheep.

To protect tissues from oxidative damage, animals scavenged the activity of free radicals produced by endogenous antioxidant defence systems (Sun et al. 2020). The enzymatic antioxidants including catalase (CAT), superoxide dismutase (SOD), malonaldehyde (MDA) and glutathione peroxidase (GPx) played a crucial role in regulating lipid mobilization during inflammatory diseases (Abou-Rjeileh and Contreras 2021) and protected cells from oxidative damage (Locatelli et al. 2003). Therefore, oxidative stabilities were used as key means of surveying the adipose tissue function.

To reduce the pressure of grazing on natural pastures, and effectively solve the inherent contradiction between production and ecology, the traditional grazing in the pasturing areas of China is gradually changing to stall-feeding. Currently, little data exist regarding the impact of concentrate supplements on the physicochemical property of the subcutaneous fat in Black Tibetan sheep. Therefore, the objectives of the present study are to evaluate the effect of different ratios of concentrate: forage (C: F) diets on fat deposition, fatty acid composition, oxidative stability, mRNA relative abundance of genes associated with adipose tissue metabolism of subcutaneous fat in Black Tibetan sheep.

2. Materials and methods

2.1. Animals and diets

The feeding trial was conducted from March 1. 2021 to July 8, 2021 in Guinan County, Qinghai Province, China (Coordinate 100^о75'N, 35^о57'E). Ten days were used to adapt to the diet changes and the experiment lasted for 120 d. Fifteen healthy 2-month-old weaned non-neutered male lambs with similar parity and weight (10.05 ± 0.96 Kg) were randomly selected from the Black Tibetan sheep breeding centres of Guinan County. All individuals were chosen from single lambs and were randomly divided into three treatment groups. Three dietary treatments were formulated to produce different C: F ratios (Table 1), which were 70:30, 50:50 and 30:70 for high C: F (HC), intermediate C: F (IC) and low C: F (LC), respectively. Each group was provided with dietary feed twice daily (10:00 and 18:00). Diets and fresh drinking water were offered ad libitum. Daily nutrient requirements were met for all lambs (NRC 2007).

Table 1. Ingredient and analyzed composition (DM basis) of experimental diets formulated to contain varying C:F fed to black Tibetan Sheep.

Items	Treatments
	LC	IC	HC
Ingredients, %
Oaten hay	35.00	25.00	15.00
Oat silage	35.00	25.00	15.00
Corn	16.14	30.06	40.05
Rapeseed meal	2.28	7.45	14.13
Cottonseed meal	2.22	3.10	6.39
Soybean meal	2.16	2.19	2.23
NaCl	0.80	0.80	0.80
Limestone	0.80	0.80	0.80
NaHCO3	0.10	0.10	0.10
CaHPO4	0.50	0.50	0.50
Premix^1）	5.00	5.00	5.00
Analyzed composition
DE, MJ/kg	12.58	12.61	12.65
Crude protein, %	13.78	13.82	13.86
Ash, %	4.65	4.64	4.62
Ether extract, %	3.91	4.95	4.01
Neutral detergent fibre, %	45.14	36.26	26.33
Acid detergent fibre, %	29.17	22.68	16.15
Ca, %	0.24	0.24	0.23
P, %	1.13	1.12	1.12

^a Provided per kilogram of diets: Cu 15 mg, Fe 55 mg, Zn 25 mg, Mn40 mg, Se 0.30 mg, I 0.5 mg, Co 0.20 mg, VA 20 000 IU, VD 4 000 IU, VE 40 IU.

2.2. Fat deposition

At the end of the feeding experiment, fifteen lambs (n = 5 per treatment) were transported to a nearby commercial slaughterhouse and humanely slaughtered according to animal welfare procedures. Using the vernier caliper, the thickness of backfat was measured from the subcutaneous fat (between the 12th and 13th ribs) at the right side of the carcass. Synchronously, adipose tissue was taken under aseptic conditions, flashed frozen in liquid nitrogen and stored at −80℃ pending analysis.

2.3. Biochemical analysis

After slaughtering, subcutaneous fat (n = 3 per lamb) was collected. Approximately 1.0 g of subcutaneous fat was homogenized in ice-cold physical saline at a ratio of 1:9 (w/v) and subsequently centrifuged at 3000×g at 4℃ for 10 min to obtain supernatants. Then, the oxidative stabilities, including malondialdehyde (MDA), glutathione peroxidase (GSH-Px), superoxide dismutase (SOD), total antioxidant capacity (T-AOC) and catalase (CAT) in the supernatants were estimated using the enzymatic reagent kits (Nanjing Jiancheng Bioengineering Institute, China) following the manufacturer’s instructions. All experiments were repeated three times.

2.4. Fatty acid analysis

Triplicated 1 g of blended subcutaneous fat (n = 5 per treatment) was transmethylated with 40 mL of metaphosphoric acid for 2 h of incubation at room temperature, then centrifuged at 12000×g at 4℃ for 15 min to obtain supernatants. Volatile fatty acids in supernatant were measured using gas chromatography (GC-2014, Kyoto, Japan) with a flame ionization detector. The split injection ratio was 50:1. The carrier gas was helium at 3.0 mL/min with a split ratio of 100:1(v/v). The injector and detector temperatures were 260℃. The initial temperature of the oven was 140℃ for 5 min. The oven temperature programmed run was increased to 240℃ at a rate of 4℃/min. The peak of individual fatty acids was identified and quantified by the comparison of the retention time and peak area with the standard fatty acid methyl esters. The composition of fatty acids was expressed as percentages of total fatty acids.

2.5. qPCR analysis

Total RNA was isolated from the adipose tissue using a Trizol reagent (Takara Biotechnology Co. Ltd., Dalian, China). Reverse transcription of total RNA was completed using a PrimeScript RT Master Mix kit (Takara Biotechnology Co. Ltd.). Currently, both β-actin and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were used as housekeeping genes to normalize the results. The qPCR was conducted by the Applied Biosystems 7500 Fast Real-Time PCR System (Applied Biosystems, U.S.A.) with the SYBR® Premix Ex TaqTM kit (TaKaRa, Dalian, China). All specific primers used are listed in Table 2. The quantified relative mRNA expression levels were calculated using the 2^-△△Ct method (Gui et al. 2020).

Table 2. Primers used in these experiments.

Gene	GenBank accession	Primer sequence (5’ to 3’)	Tm (°C)	Product length (bp)
SIRT1	XM_015104377.3	AAACTTTGCTGTAACCCTGTG	60.0	178
		GGTCTAAAAGAGCGACAATCA
SIRT2	XM_027978260.2	ACGCCAACCTGGAGAAATAC	60.0	132
		AGATGGTGGGCTTGAACTGC
SIRT3	XM_004019744.5	GAGGATGGTCCGTATCTTGT	60.0	121
		CTCTGGCAGGCTCTGGTCTT
SIRT4	XM_027980225.2	GACGGCGATGTCTTTCTCAC	60.0	156
		GGCTTCATTCACCCTCTTGT
SIRT5	XM_027959174.2	TGGTCATAACCCAGAACATC	60.0	116
		CTCAGCCACAACTCCACAAG
SIRT6	XM_042250145.1	CAAGGGCAAGTGCGGTCTAC	60.0	231
		GGCTGGGCATTCTCAAAGGT
SIRT7	XM_042256240.1	GTCCGCAATGCCAAATACCT	60.0	130
		CAGCAGCACTAACACTTCTTCCT
β-actin	NM_001009784.3	CGTCCGTGACATCAAGGAGAAGC	60.0	143
		GGAACCGCTCATTGCCGATGG
GAPDH	NM_001190390.1	CGGCACAGTCAAGGCAGAGAAC	60.0	115
		CACGTACTCAGCACCAGCATCAC

2.6. Statistical analysis

One-way ANOVA with Tuckey’s test was performed to compare the differences in relative abundances among different treatments, and Duncan’s multiple comparison tests were used to determine the effects of dietary concentrate-to-forage ratios on the thickness of backfat, antioxidant traits, and the results of qPCR were analyzed as a randomized complete block design using the PROC MIXED procedure of SAS 9.4 (SAS Institute Inc., 2001). Statistical significance was declared at 0.01 < P < 0.05 and P < 0.01 . The results are shown as the means ± SD.

3. Results

3.1. Fat deposition

The effects of dietary concentrate levels on fat deposition are summarized in Table 3. Subcutaneous fat thicknesses in the HC group showed a significant increase compared to those in the IC and LC groups (P < 0.05), indicating the positive relationship between dietary concentrate supplementation and deposition of subcutaneous fat.

Table 3. Effect of different ratios of C:F diets on the subcutaneous fat deposition in subcutaneous fat.

Items	LC	IC	HC	P-values
Subcutaneous fat thicknesses (cm)	4.23 ± 0.47^b	4.69 ± 0.37^b	5.72 ± 0.68^a	0.035

Note: Data in the table were ‘Mean ± SD’. Data marked with a different superscript with the same row differ significantly (P < 0.05).

3.2. Fatty acid profile

The effect of different ratios of C: F diets on the fatty acid composition of subcutaneous fat is presented in Table 4. A total of 18 fatty acids were detected in the subcutaneous fat of Black Tibetan sheep. With an increase in dietary concentration, polyunsaturated fatty acid (PUFA) content decreased linearly (P < 0.05). Additionally, the concentration of C15:1 and C18:2n significantly increased with a decrease in the proportion of dietary concentrate (P < 0.05).

Table 4. Effect of different ratios of C:F diets on the fatty acid composition in subcutaneous fat (% total identified FA).

Items	LC	IC	HC	P-values
C10:0	0.14 ± 0.03	0.15 ± 0.03	0.15 ± 0.04	0.241
C12:0	0.10 ± 0.02	0.10 ± 0.03	0.11 ± 0.02	0.078
C14:0	2.56 ± 0.46	2.87 ± 0.39	2.93 ± 0.19	0.052
C15:0	0.82 ± 0.09	0.86 ± 0.03	0.85 ± 0.02	0.118
C16:0	23.05 ± 1.03	24.41 ± 0.92	24.67 ± 1.44	0.325
C17:0	2.16 ± 0.12	2.21 ± 0.17	2.22 ± 0.04	0.214
C18:0	18.02 ± 1.68	17.98 ± 1.34	18.03 ± 2.01	0.350
C14:1	0.36 ± 0.08	0.34 ± 0.06	0.33 ± 0.05	0.068
C15:1	0.29 ± 0.09^a	0.21 ± 0.06^b	0.20 ± 0.07^b	0.015
C17:1	1.70 ± 0.26	1.67 ± 0.18	1.66 ± 0.14	0.103
C21:1	0.33 ± 0.05	0.32 ± 0.06	0.33 ± 0.05	0.138
C16:1n7c	2.01 ± 0.19	2.08 ± 0.17	2.13 ± 0.03	0.386
C18:1n9c	39.02 ± 3.43	38.86 ± 2.51	38.24 ± 4.42	0.775
C18:1n9t	2.47 ± 0.43	2.34 ± 0.33	2.33 ± 0.18	0.235
C20:1	0.29 ± 0.06	0.26 ± 0.05	0.26 ± 0.04	0.097
C18:2n	2.13 ± 0.11^a	1.78 ± 0.09^b	1.65 ± 0.08^b	0.030
C18:3	0.17 ± 0.08	0.16 ± 0.04	0.16 ± 0.05	0.621
C18:3n3	0.29 ± 0.08	0.28 ± 0.05	0.27 ± 0.06	0.278
Unsaturated fatty acids (UFA)	45.85 ± 1.45	47.58 ± 2.14	47.96 ± 1.98	0.157
Monounsaturated fatty acids (MUFA)	45.67 ± 0.93	44.95 ± 1.02	44.17 ± 1.74	0.085
Polyunsaturated fatty acids (PUFA)	2.59 ± 0.41^a	2.32 ± 0.56^ab	2.18 ± 0.20^b	0.022

Note: Data in the table were ‘Mean ± SD’. Data marked with a different superscript with the same row differ significantly (P < 0.05).

3.3. Antioxidant capacity

As shown in Table 5, both GSH-Px and SOD activities significantly increased as the dietary concentration levels decreased (P < 0.05). Although no significant difference (P < 0.05), the T-AOC activity presented a decreasing tendency with an increase in dietary concentration (P > 0.05). However, the MDA content presented a contrary increasing trend with an increase in dietary concentration (P > 0.05).

Table 5. Effect of different ratios of C:F diets on the antioxidant capacity in subcutaneous fat.

Items	LC	IC	HC	P-values
T-AOC ng/mL	2.63 ± 0.21	2.29 ± 0.25	2.10 ± 0.20	0.118
CAT U/mL	43.27 ± 1.04	42.96 ± 1.39	38.87 ± 2.66	0.088
GSH-Px U/mL	425.99 ± 27.48^a	417.04 ± 13.49^a	381.03 ± 14.07^b	0.035
SOD U/mL	161.47 ± 14.20^a	148.53 ± 11.82^ab	132.30 ± 7.29^b	0.014
MDA nmol/mL	7.21 ± 0.44	7.50 ± 1.07	7.69 ± 0.30	0.263

Note: Data in the table were ‘Mean ± SD’. Data marked with a different superscript with the same row differ significantly (P < 0.05).

3.4. Gene expression levels related to lipid metabolism

As presented in Figure 1, dietary concentrate supplementation significantly affected the expression level of SIRT1 and SIRT2. The expression level of SIRT1 significantly decreased in the HC group compared to the other groups (P < 0.01). The SIRT2 expression level was downregulated (P < 0.05) with increasing concentrate supplementation. There was no difference in the expression of SIRT3-7 among the treatments (P > 0.05).

Figure 1. Effect of different ratios of C:F diets on the expression of Sirtuins in subcutaneous fat. Values with different lowercases or uppercases within the same column or row mean significant difference at P < 0.05 or P < 0.01, respectively. NS mean not significant.

4. Discussion

Black Tibetan sheep (Ovis aries), indigenous livestock on the Tibetan Plateau, were characterized by adaptation to the harsh environment, providing precious resources including meat, milk, wool and dung as fertilizer and fuel for local Tibetan (Gui et al. 2021). Due to the extreme environment in the Qinghai-Tibet Plateau (average altitude of 4,500 m), it was a major challenge for the livestock industry to rapidly increase the production of livestock (Li et al. 2021). By supplying concentrate in the diet, at least in part, could contribute to overcome the long growth cycle in Black Tibetan sheep under traditional grazing (Peng et al. 2015).

The fat deposition was characterized by increasing in number and/or adipocyte size, which was mainly found in visceral depots, subcutaneous depots, intermuscular depots and intramuscular depots (Zhang et al. 2021). Among those, the subcutaneous fat was considered a pivotal fat depot since it acted as a nutrient ‘bank’ in situations of excessive energy availability (Tran et al. 2008). In the Tibet Plateau, postnatal hypothermia and cold stress were prevented by subcutaneous depots in a mammal during the cold season. Lopreiato et al. (2018) evaluated the effects of dietary energy levels (100% and 180%) in Holstein cows and found that increasing nitrogen concentration increased adipose tissue mass by stimulating the transcription of key genes associated with adipogenesis and lipogenesis (Lopreiato et al. 2018). Song et al. (2017) demonstrated that sequential energy restriction, as might be experiencing during seasonal forage quality and quantity changes in natural grasslands, results in lesser subcutaneous fat in sheep (Song et al. 2017). In this study, the subcutaneous depots mass was obviously increased with increasing dietary C:F ratios, which is in agreement with previous findings (Gubbels et al. 2021). It was speculated those alterations in nutrient supply led to changes in fat distribution patterns by regulating expression patterns of genes associated with lipid metabolism and inflammatory responses in adipose tissues.

PUFA were characterized by straight-chain fatty acids of 18–24 carbon atoms containing multiple double bonds, which were involved in a variety of functions within biological systems including cellular stability, lipoprotein balance and cytokine secretion (Zhang et al. 2018). Currently, PUFA contents showed a continued decline with increasing dietary C: F ratios, indicating that excessive nutrition intake from concentrate supplements was, at least in part, negatively correlated with organismal health. C18:2n belonging to the ω-6 PUFA was an essential fatty acid and promoted the synthesis of conjugated linoleic acid (Bao et al. 2021). While C15:1 was an important monounsaturated fatty acid (MUFA) with the function of reducing cholesterol and preventing coronary heart disease. In this study, both C18:2n and C15:1 contents in the low-concentrate treatment were higher than other groups, which is in agreement with previous findings in ruminants (Queiroz et al. 2021).

As a primary enzymatic-antioxidant defence, SOD protected cellular normal physiological conditions from membrane rupture and lipid peroxidation, thereby maintaining the internal dynamic balance (Fan et al. 2021). Similarly, tissue GPx activity reflected the extent of lipid peroxidation and was used for the removal of reactive oxygen species (Wang et al. 2021). Currently, both SCD and GPx activities were significantly decreased as dietary concentration increased from 30 to 70%, indicating that relatively high dietary concentration levels led to an increased risk of peroxidation and imposed a peroxidation burden in intramuscular fat.

The ovine SIRT1 is mapped to chromosome 25 and its coding region consists of 9 exons. In vivo and in vitro, SIRT1 suppressed rodentine adipogenesis by deacetylating the histones of secreted frizzled-related protein1 (sFRP1), secreted frizzled-related protein1 (sFRP2) and Dapper1 (Dact1) and activating Wnt signalling pathways (Zhou et al. 2016). Overexpression of SIRT1 in visceral adipose stem cells resulted in the reduction of markers of adipogenic differentiation, such as CCAAT enhancer binding protein alpha (CEBPA), peroxisome proliferator-activated receptor gamma2 (PPARG2), fatty acid synthase (FASN) and sterol regulatory element binding protein-1c (SREBP-1c), thereby regulating the differentiation of mammalian adipocyte precursors (Perrini et al. 2020). The ovine SIRT2 localized on chromosome 14, containing 16 exons, and is highly expressed in the reticulum, muscle and subcutaneous fat. By targeting SIRT2, miR-212 regulated the expression of lipogenesis-related genes, such as fatty acid synthetase (FAS) and SREBP1, which was associated with lipogenesis in mammary epithelial cell lines (Lu et al. 2020). In human visceral adipose stem cells, overexpression of SIRT2 resulted in the inhibition of adipocyte differentiation, whereas knockdown of SIRT2 promoted this process (Perrini et al. 2020). In this study, with the decreased dietary concentrate supplementation, the mRNA expression levels of SIRT1 and SIRT2 decreased. It is postulated that the dietary nutrient density may directly or indirectly affect the lipid metabolism in subcutaneous fat by regulating the mRNA expression of SIRT1 and SIRT2. Our observation was in agreement with that of Zhang et al. (2022), who found that reduction of SIRT1 expression by dietary resveratrol supplementation contributed to intramuscular fat deposition in growing-finishing pigs (Zhang et al. 2019).

5. Conclusion

Concentrate supplementation was essential to fulfill the nutrient requirements during the cold season in Black Tibetan sheep. However, excessive concentrate supplementation (70%) in the diet is not recommended in Black Tibetan sheep, considering that no benefits were observed for nutrient utilization, oxidative stability or economic returns, while the supplementation of C: F at 50:50 proved to be suitable for finishing lambs.

Acknowledgements

Princess Nourah bint Abdulrahman University Researchers Supporting Project number (PNURSP2023R402), Princess Nourah bint Abdulrahman University, Riyadh, Saudi Arabia

Disclosure statement

No potential conflict of interest was reported by the author(s).

Correction Statement

This article has been corrected with minor changes. These changes do not impact the academic content of the article.

Additional information

Funding

The current work was funded by Construction of Standardized Production System for Improving quality and efficiency of Tibetan sheep industry (2022-NK-169) and Evaluation and Analysis of Nutritional Value of Black Tibetan Sheep and Research on Development of Series Products Funds of Qinghai Province (2020-GN-119).