The effect of dietary resveratrol supplementation on growth performance, carcase trait, meat quality and antioxidant status of Chinese indigenous chicken

ABSTRACT

This study was conducted to explore the effects of resveratrol on production performance of Chinese indigenous broilers. A total of 432 female broilers (1-day-old) with similar BW were selected and randomly allotted to 4 groups with 6 replicated of 18 birds each. These four groups were fed on a 0, 250, 500, or 1000 mg/kg resveratrol supplemented basic diet for 51 days. The results demonstrated that birds in the resveratrol treated groups exhibited higher final BW and ADG, and lower F/G ratio. The resveratrol treatments also resulted a higher breast and drumstick muscle rates, relative jejunum weight, relative jejunum length, and lower abdominal fat rate. The serum biochemical parameters were positively affected by each resveratrol treatment, including TP, GLB, TC, LDL, and ALP. The L*_45min and shear force values of both breast and drumstick muscle tissues were significantly reduced in the resveratrol treatments, whilst resveratrol treatments induced higher a*_45min in breast muscle tissue and lower b*_45min in drumstick muscle tissue compared the basic diet treatment. In addition, dietary resveratrol supplementation significant reduced the MDA content and elevated the activity of anti-oxidative enzymes in serum and liver tissue, as well as up-regulated the mRNA expression of Nrf2 gene and antioxidant genes (HO-1, GPX, and CAT) in drumstick muscle tissues. Collectively, this study determined that dietary supplementation with 250 and 500 mg/kg resveratrol improved the growth performances, carcass characters, and meat quality of Chinese indigenous broiler chickens.

KEYWORDS:

• Indigenous chicken
• resveratrol
• growth performance
• carcase trait
• meat quality
• antioxidant status

1. Introduction

In the past decades, the production efficiency of broiler chickens was continuously maximized through nutrition, genetic breeding and management strategies, as indicated by the improvement of feed conversion ratio, daily weight gain and mortality rate (Utnik-Banas et al. 2018). In 2021, Global chicken meat production has elevated at about 99.90 million tons, making a significant contribution to meet the demands of people. Consumers pay increasing attention to the quality of chicken meat as living standards improve, and as a result, new requirements to producers are put forward for higher meat quality. However, genetic breeding practice indicated that it was hard to enhance meat quality without impairing the production efficiency as a negative genetic correlation exhibited in these two performance traits (Hermesch 2008). Therefore, nutrition is one of the key parameters to accelerate meat quality improvement. Numerous nutrients have been reported to result in meat quality improvement, such as natural plant polyphenols (Saleh et al. 2014; Zhang et al. 2018; Selim et al. 2021), food-grade chemical compounds (Pecjak et al. 2022) and probiotics (Mohammed et al. 2021).

Poultry meat is particularly susceptible to stress damage due to the genetic selection toward lean, large breast and drumstick muscle, as well as fast growth (Sihvo et al. 2014). The oxidative stress is triggered by several parameters, including heat exposure, handling and oxidized dietary oils, and it further impair the growth performance, meat quality and immune response (Estevez 2015; Saleh et al. 2019b). Numerous factors that induce oxidative stress negatively affect the epithelial cell’s tight junctions and intestinal barrier’s integrity through cell apoptosis (Mayangsari and Suzuki 2018), which further affected the digestion and absorption of nutrients as well as the immune response of animals (Saleh 2014). Furthermore, muscle antioxidative capacity is a key indicator to evaluate meat quality. Muscle lipid oxidation has been considered as a crucial threat to meat quality, since negatively affects flavour, colour and texture, as a result of the high unsaturation degree of muscle lipids (Min and Ahn 2005). In addition, muscle protein oxidation has been correlated with an increase in toughness and hardness (Utrera et al. 2014), impairment of water-holding capacity (Leygonie et al. 2012) and loss of essential amino acids (Dominguez et al. 2022). Therefore, a promising strategy is indispensable to retard the oxidative damage on growth performance and meat quality in the modern poultry farming industry, for example, dietary antioxidative nutrients supplementation (Saleh et al. 2019a).

Resveratrol (trans-3,5,4′-trihydroxystilbene) is a natural plant polyphenol compound that can be extracted from a great variety of natural plants, including white squash, Polygonum cuspidatum, red grapes, peanuts, etc. (Tian and Liu 2020). In addition, the resveratrol has been reported to participate in multiple physiological processes, including anti-inflammatory and anti-oxidant (Meng et al. 2021; Cui et al. 2022). In poultry, it has been investigated that dietary resveratrol supplementation plays crucial roles in maintaining high growth performance and improved health status through protecting intestinal barrier’s integrity (Zhou et al. 2022), regulating gut microbiota (He et al. 2022), alleviating inflammation (Yang et al. 2021b), and relieving liver and spleen damage (Liu et al. 2021; Meng et al. 2022). Furthermore, resveratrol is also proved as an excellent antioxidant nutrient to ameliorate meat quality, which could reduce the oxidation of muscle protein and lipid (Jin et al. 2021), stimulate favourable amino acids deposition (Yu et al. 2021) and maintain muscle energy metabolism (Zhang et al. 2017).

Dietary resveratrol possibly contributes to the enhancement of the antioxidant capacity of tissues or body through activating the Nrf2 signalling pathway and further elevating the expression of antioxidant-related genes, such as haem oxygenase-1 (HO-1), NADPH quinone oxidoreductase 1 (NQO1) and glutathione peroxidase (GSH-Px) (Yang et al. 2021a; Zhao et al. 2022b). Based on these above-mentioned findings, it could be concluded that the resveratrol had great application prospects as a functional nutrient in poultry industry. However, the effect of resveratrol on broiler production performance and meat quality has not been yet comprehensively evaluated, especially in Chinese indigenous chickens. Therefore, the objective of this study was to examine the effects of dietary resveratrol on growth performance, meat quality and antioxidant capacity of Chinese indigenous chickens.

2. Materials and methods

2.1. Birds, diets and experimental design

All female WENS Tianlu black chickens were purchased from a commercial hatchery (Tangrenshen Group Co., Ltd., Zhuzhou, China). A total of 432 birds (1-day-old) with similar body weight (BW) (the average weight was 43.38 g) were selected and randomly allotted to four groups with 6 replicates of 18 chickens per cage. Then, these four experimental groups were randomly treated as follows: (1) basal diet, (2) basal diet + 250 mg/kg resveratrol, (3) basal diet + 500 mg/kg resveratrol or (4) basal diet + 1000 mg/kg resveratrol, respectively. The basal diet was formulated according to the Nutrient Requirements of Poultry (Ministry of Agriculture of the People’s Republic of China 2020, NY∕T 3645-2020) and its ingredient composition and nutrient levels are listed in Table 1. Resveratrol (purity,>98%) was provided by Jiangxi Engineering and Technology Center for Natural Products. Birds were provided ad libitum access to water and powdered diets. Birds, feedstuff and water facilities were checked thrice daily, and the mortality rate was recorded. The experiment was conducted between July and August 2021 in a commercial broiler farm (Nanchang, China), and lasted for 51 days.

Table 1. The composition and nutrient levels of the basal diets.

Items	Content
	1–21 days	21–51 days
Ingredients (%)
Corn	56.48	57.85
Soybean meal (43% CP)	29.63	28.22
Corn gluten meal (52% CP)	0.70	2.5
Wheat bran	4.60	2.5
Soybean oil	4.40	5
Lysine	0.26	0.22
Methionine	0.29	0.26
Threonine	0.09	0.05
CaHPO4	1.70	1.75
Limestone	1.36	1.15
Premix^a	0.48	0.5
Total	100.00	100.00
Calculated nutrient levels
Metabolizable energy (MJ/kg)	12.54	12.97
Crude protein (%)	19.77	19.58
Ca (%)	1.00	0.92
Total phosphorus (%)	0.66	0.65
Lysine	1.16	1.10
Methionine	0.59	0.57
Threonine	0.80	0.77

^a Vitamin and mineral premix provided per kilogram of diet: vitamin A, 12,500 IU; vitamin D3, 3,000 IU; vitamin E, 25 IU; vitamin B1, 3 mg; vitamin B2, 6.5 mg; vitamin B12, 0.2 mg; vitamin K3, 3.25 mg; biotin, 0.08 mg; folic acid, 1.5 mg; d-pantothenic acid, 12.5 mg; nicotinic acid, 45 mg; copper, 8 mg; iron, 80 mg; zinc, 40 mg; manganese, 60 mg; selenium, 0.15 mg; iodine, 0.35 mg.

2.2. Record of growth performance

The BW of birds in each replicate were measured at 21-day-old and 51-day-old after a nine-hour fasting. Feed intake was recorded daily. Then, the growth performance characteristics were calculated, including average daily gain (ADG), average daily feed intake (ADFI) and feed-to-gain ratio (F/G).

2.3. Sample collection and preparation

At the end of the trial, three birds with nearly the average weight were randomly selected from each replicate for sampling. A total of 18 birds per group were euthanized by cervical dislocation. About 5 mL of blood from each bird was collected and then centrifuged for serum collection with 2000× g for 10 min at 4°C. The serum samples were stored at −20°C for further analysis. The carcase traits were then measured and calculated according to the poultry production performance noun terms and metric statistics method (NY/T823-2004). The tissue samples from breast muscle, drumstick muscle and liver were collected for the determination of meat quality and antioxidant biomarkers using conventional methods. The duodenum was isolated from the gizzard to the bile duct, the jejunum was obtained from the bile duct to Meckel’s diverticulum, and the ileum was sampled from Meckel’s diverticulum to the ileocecal junction. These above-mentioned intestine tissue samples were washed with phosphate buffer saline (pH = 7.4) and were dried using filter paper. Then, they were used to measure the relative length (cm/kg of live BW) and relative weight (g/kg of live BW). The liver, thymus, spleen and Bursa of Fabricius were excised and weighed. Then, the organ index was calculated as the organ fresh weight/BW.

2.4. Serum biochemical analysis

Serum biochemical parameters were determined using the specific kits purchased from Nanjing Jiancheng Institute of Bioengineering (Nanjing, China) on an automatic biochemical analyzer (BS-200, Shenzhen Mindray Bio-medical Electronics Co., Ltd., Shenzhen, China), including glucose (GLU), total protein (TP), albumin (ALB), globulin (GLB), triacylglycerol (TG), total cholesterol (TC), high-density lipoprotein (HDL), low-density lipoprotein (LDL), free fatty acid (FFA), adiponectin (ADPN), D(-)-lactic (DLA), alkaline phosphatase (ALP), aspartate aminotransferase (AST) and alanine aminotransferase (ALT).

2.5. Meat quality analysis

Meat quality characteristics of muscle tissues from breast and drumstick were assessed in the present study, including colour, pH, drip loss, cooking loss and shear force. In brief, meat colour parameters including lightness (L*), redness (a*) and yellowness (b*) were measured at 45 min postmortem using a chromameter CR-400 (Konica Minolta, Osaka, Japan). The pH values at 45 min and 24 h following slaughter were determined using a digital pH-meter (Testo 205, Testo SE & Co, Lenzkirch, Germany). The drip loss of muscle samples was measured using the plastic bag method. The weighted fresh muscle samples were hung in plastic bags with iron wire and stored at 4°C for 24 h. To determine the cooking loss, muscle samples without fascia and fat were weighted and heated in a steamer for 20 min at 80°C, and then weighted again after being cooled at 26°C (Zhang et al. 2018). These cooled muscle samples were further cut into 2 cm long stripes to measure the share force using a shear apparatus (C-LM3B, Harbin, China).

2.6. Antioxidant enzyme activity analysis

The liver tissue samples were homogenized in ice-cold 0.9% saline solution for 1 min. The homogenate was centrifuged at 2200× g for 10 min at 4°C, and then the supernatant was collected for further analysis. The activity of antioxidant enzymes in serum and liver tissue was determined according to the instructions provided by a series of specific commercial ELISA kits from Nanjing Jiancheng Bioengineering Institute (Nanjing, China) on an automated spectrophotometer (Biomate 5, Thermo Electron Corporation, Rochester, NY), including malondialdehyde (MDA), total antioxidant capacity (T-AOC), glutathione peroxidase (GSH-Px), total superoxide dismutase (T-SOD) and catalase (CAT).

2.7. Real time quantitative PCR

Total RNA was extracted from drumstick muscle tissue samples using TRIzol reagent (Invitrogen, United States) according to the manufacturer’s protocols. Then, the cDNA of each sample was synthesized using a PrimeScript first strand cDNA synthesis kit (TaKaRa, China) according to the protocol provided by the manufacturer. The primers were designed using the Oligo 6.0 software (Table 2) and synthesized by Sango Bio. (Shanghai, China). The real-time quantitative PCR (qRT-PCR) mixture contained 12.5 μL SYBR Premix Taq™ (2×, TaKaRa, China), 2.0 μL cDNA, 1 μL each of forward and reverse primers and 8.5 μL ddH₂O. The qRT-PCR amplifications were performed on a Thermo Scientific PIKO REAL 96 real-time PCR System (Thermo Scientific, United States) with the thermal cycling programme as follows: 95°C for 10 min, followed by 40 cycles of 95°C for 10 s, 59°C for 50 s. The β-actin was used as the internal control. The relative expression of each gene was evaluated using the 2^△△Ct method.

Table 2. Sequences of the primers used in the present study.

Gene	F (5′→3′)	R (5′→3′)	Accession No.
Nrf2	TTCGCAGAGCACAGATACTTC	TGGGTGGCTGAGTTTGATTAG	NM_205117.1
Keap1	CTGCTGGAGTTCGCCTACAC	CACGCTGTCGATCTGGTACA	KU321503.1
HO-1	TGTCCCTCCACGAGTTCAAG	CTCCAGTTGCTGCCATAGAA	NM_205344.1
GPX	AAGTGCTGCTGGTGGTCAACG	GTTCTCCTGGTGCCCGAATTGG	NM_001277853.2
GST	GGAAGCCATTTTAATGACAGA	TCCTTTAAAAGCCTGTAGCAGA	XM_015284825.2
CAT	AGCAGGTGCCTTTGGCTATT	CGAGGGTCACGAACTGTATCA	NM_001031215.2
NQO1	CTCCGAGTGCTTTGTCTACGA	ATGGCTGGCATCTCAAACC	NM_001277621.1
β-actin	AGCCAACAGAGAGAAGATGACAC	CATCACCAGAGTCCATCACAATA	NM_205518.1

Note: Nrf2, NF-E2-related factor 2; Keap1, Kelch-like ECH-associated protein 1; HO-1, Haem oxygenase 1; GPX, Glutathione peroxidase; GST, glutathione S-transferase; CAT, Catalase; NQO1, NAD (P)H/quinone oxidoreductase 1.

2.8. Statistical analysis

Data were subjected to a one-way ANOVA, followed by Duncan’s multiple-comparison test of significance using SPSS 19.0 software (IBM, United States). Results are presented as mean ± standard deviation (SD). p < 0.05 and p < 0.01 are considered as being statistically significant.

3. Results

3.1. Growth performance

The growth performance of chickens during the 51-d experimental period is shown in Table 3. In the early stage (1–21 days), dietary resveratrol supplementation (250, 500 and 1000 mg/kg) significantly enhanced the final BW (p < 0.01) and ADG (p < 0.01), and dietary supplementation at the levels of 250 and 500 mg/kg with resveratrol significantly decreased the F/G ratios (p < 0.05) when compared with those of the basal diet. In the later stage (21–51 days), the effects of dietary resveratrol supplementation on the final BW and F/G ratio were similar to those in the early stage, whereas only dietary supplementation with 1000 mg/kg resveratrol significantly increased the ADG. During the 51-day experimental period, these three dietary resveratrol supplementation groups exhibited average 10.98% higher ADG value (p < 0.01) and average 12.94% lower F/G ratio, respectively. In addition, no statistically significant difference was detected in the mortality rate among these four groups.

Table 3. Effect of dietary resveratrol supplementation on the growth performance of Chinese indigenous chickens.

Items	Resveratrol (mg/kg)				p-value
	0	250	500	1000
	1–21 days
Initial BW (g)	43.57 ± 0.9	43.21 ± 0.75	43.41 ± 0.62	43.33 ± 0.58	0.713
Final BW (g)	291.62 ± 23.20^b	342.16 ± 9.07^a	348.32 ± 10.13^a	325.91 ± 22.81^a	0.001
ADG (g/d)	11.81 ± 1.12^b	14.24 ± 0.43^a	14.52 ± 0.57 ^a	13.46 ± 1.07^a	0.001
ADFI (g/d)	32.55 ± 2.96	32.17 ± 2.63	32.27 ± 2.84	32.62 ± 1.91	0.947
F/G	2.76 ± 0.34^a	2.26 ± 0.19^b	2.22 ± 0.24 ^b	2.42 ± 0.28^ab	0.017
	21–51 days
Initial BW (g)	291.62 ± 23.20^b	342.16 ± 9.07^a	348.32 ± 10.13^a	325.91 ± 22.81^a	0.001
Final BW (g)	1056.99 ± 54.92^b	1159.53 ± 65.68^a	1173.43 ± 56.71^a	1167.33 ± 45.93^a	0.006
ADG (g/d)	25.51 ± 1.29^b	27.25 ± 2.26 ^ab	27.50 ± 2.04 ^ab	28.05 ± 0.97^a	0.043
ADFI (g/d)	107.85 ± 6.08	105.32 ± 11.96	103.73 ± 7.29	99.71 ± 5.67	0.261
F/G	4.23 ± 0.11^a	3.86 ± 0.28^b	3.77 ± 0.21^b	3.56 ± 0.21^c	<0.001
	1–51 days
ADG (g/d)	19.87 ± 1.07^b	21.89 ± 1.29^a	22.16 ± 1.18 ^a	22.04 ± 0.90^a	0.006
ADFI (g/d)	70.20 ± 2.89	68.75 ± 6.98	68.00 ± 4.86	66.17 ± 3.19	0.353
F/G	3.53 ± 0.12^a	3.14 ± 0.24^b	3.07 ± 0.19 ^b	3.01 ± 0.21^b	<0.001
Mortality rate (%)	0	0	0	0	–

Note: BW, body weight; ADG, average daily gain; ADFI, average daily feed intake; F/G, feed-to-gain ratio.

^abc Different superscript letters indicate significant differences (p < 0.05).

3.2. Carcase and intestinal characteristics

As presented in Table 4, no significant difference (p > 0.05) was found in dressing percentage, eviscerated yield, liver index, spleen index and fabricius index among these four groups. Compared with the basal diet group, the breast muscle rate of 500 mg/kg resveratrol group significantly elevated by 32.60% (p < 0.05). Dietary supplementation with 250, 500 and 1000 mg/kg resveratrol increased by 31.01%, 29.89% and 27.53% the drumstick muscle rate (p < 0.05) and decreased by 43.24%, 46.85% and 16.22% the abdominal fat rate (p < 0.05) when compared with that of the basal diet group, respectively.

Table 4. Effect of dietary resveratrol supplementation on the carcase performance of Chinese indigenous chickens.

Items	Resveratrol (mg/kg)				p-value
	0	250	500	1000
Dressing percentage (%)	91.85 ± 2.29	91.5 ± 1.74	91.78 ± 1.58	92.53 ± 3.04	0.761
Eviscerated yield (%)	71.34 ± 6.37	76.66 ± 1.78	75.42 ± 1.81	72.82 ± 6.92	0.352
Breast muscle rate (%)	14.15 ± 3.15^b	16.37 ± 2.49^ab	18.86 ± 2.17^a	17.43 ± 2.68^ab	0.045
Drumstick muscle rate (%)	15.22 ± 2.61^b	19.94 ± 1.05^a	19.77 ± 1.16^a	19.41 ± 1.98^a	0.038
Abdominal fat rate (%)	1.11 ± 0.38^a	0.63 ± 0.18^b	0.59 ± 0.21^b	0.93 ± 0.44^ab	0.007
Liver index	2.12 ± 0.14	2.23 ± 0.15	2.17 ± 0.13	2.05 ± 0.14	0.126
Thymus index	0.23 ± 0.10^b	0.38 ± 0.08^a	0.24 ± 0.06^b	0.23 ± 0.05^b	0.009
Spleen index	0.19 ± 0.06	0.17 ± 0.04	0.18 ± 0.05	0.18 ± 0.03	0.827
Fabricius index	0.34 ± 0.06	0.32 ± 0.09	0.31 ± 0.06	0.29 ± 0.05	0.450

^abc Different superscript letters indicate significant differences (p < 0.05).

Interestingly, the relative jejunum weight of chickens from 500 to 1000 mg/kg resveratrol groups was obviously higher (p < 0.05) than that of the basal diet group and 250 mg/kg resveratrol group (Table 5). Furthermore, the relative jejunum length in 500 mg/kg resveratrol group was significantly longer (p < 0.05) than that of the other three groups.

Table 5. Effect of dietary resveratrol supplementation on the intestinal characteristics of Chinese indigenous chickens.

Items	Resveratrol (mg/kg)				p-value
	0	250	500	1000
	Relative intestinal weight (g/kg of live BW)
Duodenum	4.61 ± 0.12	4.64 ± 0.17	4.76 ± 0.14	4.59 ± 0.20	0.451
Ileum	7.23 ± 0.19	7.35 ± 0.21	7.54 ± 0.15	7.48 ± 0.29	0.536
Jejunum	10.11 ± 0.14^b	10.35 ± 0.11^b	11.89 ± 0.13^a	11.61 ± 0.21^a	0.043
	Relative intestinal length (cm/kg of live BW)
Duodenum	12.96 ± 0.19	13.09 ± 0.21	13.24 ± 0.17	13.19 ± 0.27	0.521
Ileum	28.49 ± 0.64	28.51 ± 0.59	28.57 ± 0.61	28.44 ± 0.48	0.448
Jejunum	26.47 ± 0.44^b	27.72 ± 0.24 ^ab	28.42 ± 0.19^a	27.89 ± 0.26 ^ab	0.044

^abc Different superscript letters indicate significant differences (p < 0.05).

3.3. Serum biochemical parameters

According to Table 6, the level of serum TP, GLB and ALP were significantly elevated (p < 0.05) in the chickens fed with 250 mg/kg and 500 mg/kg resveratrol when compared with that of the basal diet group and 1000 mg/kg resveratrol group. Dietary supplementation with 1000 mg/kg resveratrol significantly increased (p < 0.01) the serum TC level compared with that of the other three groups. In addition, chickens from these three dietary resveratrol supplementation groups showed a higher (p < 0.01) serum LDL level than that of the basal diet group. However, the level of serum GLU, ALB, TG, HDL, FFA, ADPN, D-LA, AST and ALT was not affected (p > 0.05) by dietary resveratrol supplementation.

Table 6. Effect of dietary resveratrol supplementation on serum biochemical parameters of Chinese indigenous chickens.

Items	Resveratrol (mg/kg)				p-value
	0	250	500	1000
GLU (mmol/L)	8.71 ± 0.89	8.83 ± 1.11	8.78 ± 0.98	9.07 ± 1.02	0.826
TP (g/L)	23.72 ± 4.57^b	28.73 ± 3.19^a	28.92 ± 2.91^a	21.09 ± 3.47^b	0.010
ALB (g/L)	14.95 ± 0.96	15.23 ± 1.94	15.14 ± 1.72	13.22 ± 2.20	0.085
GLB (g/L)	10.33 ± 1.55^b	13.50 ± 1.30^a	13.88 ± 1.32^a	9.65 ± 1.24^b	0.033
TG (mmol/L)	0.25 ± 0.04	0.27 ± 0.07	0.28 ± 0.06	0.24 ± 0.05	0.666
TC (mmol/L)	3.34 ± 0.45^b	4.09 ± 0.63^b	4.23 ± 0.61^b	5.20 ± 0.73^a	<0.001
HDL (mmol/L)	7.38 ± 1.18	8.13 ± 1.37	7.91 ± 0.93	7.30 ± 0.71	0.390
LDL (mmol/L)	0.18 ± 0.08^b	0.53 ± 0.19^a	0.51 ± 0.13^a	0.40 ± 0.11^a	0.001
FFA (mmol/L)	0.21 ± 0.04	0.18 ± 0.07	0.18 ± 0.03	0.18 ± 0.04	0.464
ADPN	2.30 ± 0.30	2.42 ± 0.40	2.37 ± 0.36	2.33 ± 0.19	0.766
D-LA (mmol/L)	3.13 ± 0.92	2.61 ± 0.55	2.78 ± 0.61	3.31 ± 0.90	0.328
ALP (U/L)	79.06 ± 5.43^b	63.13 ± 5.27^b	80.27 ± 4.96^b	92.03 ± 8.75^a	0.047
AST (U/L)	23.97 ± 3.34	26.00 ± 2.51	24.53 ± 3.17	24.22 ± 4.36	0.557
ALT (U/L)	7.47 ± 1.35	7.59 ± 0.92	7.28 ± 1.13	6.92 ± 1.52	0.638

Note: GLU: glucose, TP: total protein, ALB: albumin, GLB: globulin, TG: triacylglycerol, TC: total cholesterol, HDL: high density lipoprotein, LDL: low density lipoprotein, FFA: free fatty acid, ADPN: adiponectin, DLA: D(-)-lactic, ALP: alkaline phosphatase, AST: aspartate aminotransferase, ALT: alanine aminotransferase.

^abc Different superscript letters indicate significant differences (p < 0.05).

3.4. Meat quality

The results for meat quality (Table 7) demonstrated that dietary supplementation with resveratrol had no effect (p > 0.05) on pH_45min, pH_24h, drip loss and cooking loss of both breast and drumstick muscle tissues. For breast muscle tissues, all resveratrol supplementation levels significantly decreased (p < 0.05) the L*_45min and shear force when compared with those of the basal diet group. In addition, Dietary supplementation with 250 mg/kg and 500 mg/kg resveratrol significantly increased (p < 0.05) the a*_45min when compared with that of the basal diet group and 1000 mg/kg resveratrol group. Similarly, for drumstick muscle tissues, lower L*_45min and shear force (p < 0.05) as well as higher b*_45min (p < 0.05) values were detected in these three dietary resveratrol supplementation groups.

Table 7. Effect of dietary resveratrol supplementation on meat quality of Chinese indigenous chickens.

Tissues	Items	Resveratrol (mg/kg)				p-value
		0	250	500	1000
Breast muscle	L*45min	45.6 ± 3.32^a	39.46 ± 5.07^b	37.86 ± 4.79^b	36.93 ± 5.56^b	0.034
	a*45min	3.86 ± 1.28^b	4.79 ± 1.69^a	4.71 ± 1.18^a	4.18 ± 0.98^ab	0.045
	b*45min	5.84 ± 1.72	5.55 ± 1.37	4.95 ± 1.46	5.33 ± 1.21	0.651
	pH45min	6.54 ± 0.31	6.42 ± 0.29	6.58 ± 0.24	6.37 ± 0.31	0.375
	pH24h	6.01 ± 0.31	5.74 ± 0.29	5.63 ± 0.27	5.87 ± 0.31	0.291
	Shear force (N)	22.52 ± 0.18^a	20.72 ± 0.11^b	20.05 ± 0.09^b	20.07 ± 0.13^b	0.047
	Drip loss (%)	3.01 ± 0.25	2.89 ± 0.23	2.78 ± 0.27	3.12 ± 0.31	0.188
	Cook loss (%)	19.43 ± 3.35	19.90 ± 3.26	19.74 ± 3.12	20.18 ± 3.81	0.931
Drumstick muscle	L*45min	43.72 ± 3.17^a	38.16 ± 2.37^b	37.91 ± 2.19^b	38.93 ± 2.60^b	0.044
	a*45min	9.09 ± 1.82	9.32 ± 1.89	9.28 ± 2.04	9.13 ± 2.27	0.979
	b*45min	7.87 ± 0.93^a	6.63 ± 0.92^b	6.42 ± 0.79^b	6.57 ± 0.67^b	0.039
	pH45min	6.27 ± 0.12	6.18 ± 0.13	6.25 ± 0.11	6.27 ± 0.08	0.332
	pH24h	5.96 ± 0.11	5.62 ± 0.84	5.68 ± 0.45	5.55 ± 0.49	0.423
	Shear force (N)	23.75 ± 0.21^a	21.43 ± 0.17^b	21.32 ± 0.12^b	21.36 ± 0.15^b	0.034
	Drip loss (%)	3.13 ± 0.18	3.11 ± 0.26	3.08 ± 0.15	3.19 ± 0.37	0.957
	Cook loss (%)	21.27 ± 7.25	22.62 ± 4.29	21.15 ± 5.24	20.43 ± 5.31	0.803

^abc Different superscript letters indicate significant differences (p < 0.05).

3.5. Antioxidant biomarkers in serum and liver tissue

Data for antioxidant enzyme activities and MDA content in serum and liver tissue are illustrated in Table 8. For serum, compared with the basal diet group, the MDA content was significantly reduced (p < 0.05) in dietary supplementation with 500 and 1000 mg/kg resveratrol groups, whilst the T-AOC content and GSH-Px and T-SOD activities were significantly elevated (p < 0.05) in all three resveratrol treatment groups. For liver tissue, dietary supplementation with 250 and 500 mg/kg resveratrol significantly decreased the MDA content (p < 0.05) and elevated the T-AOC content (p < 0.05) when compared with those of the other two groups. In addition, dietary resveratrol supplementation induced higher GSH-Px and CAT activities (p < 0.05) when compared with those of the basal diet, whereas there was no significant difference among the three resveratrol treatments.

Table 8. Effect of dietary resveratrol supplementation on antioxidant enzyme activities and MDA content in serum and liver tissue of Chinese indigenous chickens.

Items		Resveratrol (mg/kg)				p-value
		0	250	500	1000
Serum	MDA (nmol/mL)	4.14 ± 0.38^a	3.82 ± 1.09^a	2.91 ± 0.47^b	3.06 ± 0.52^b	0.045
	T-AOC (mmol/mL)	4.70 ± 0.55^b	6.22 ± 0.50^a	7.06 ± 0.38^a	6.46 ± 0.41^a	0.041
	GSH-Px (10^2 U/mL)	27.38 ± 1.26^b	31.04 ± 1.33^a	31.19 ± 1.54^a	30.49 ± 1.84^a	0.038
	GSH (nmol/mL)	401.83 ± 0.19	405.05 ± 0.23	413.21 ± 0.13	407.97 ± 0.49	0.468
	T-SOD (U/mL)	253.12 ± 12.87^b	280.63 ± 13.84^a	310.17 ± 12.27^a	293.32 ± 11.19^a	0.032
	CAT (U/mL)	150.14 ± 0.13	163 ± 0.18	165 ± 0.12	160 ± 0.15	0.075
Liver	MDA (nmol/mL)	5.09 ± 0.02^a	4.64 ± 0.01^b	4.35 ± 0.02^b	5.10 ± 0.02^a	0.007
	T-AOC (mmol/mL)	3.49 ± 0.02^b	4.13 ± 0.01^a	4.14 ± 0.02^a	3.21 ± 0.01^b	0.041
	GSH-Px (U/mL)	371.25 ± 11.35^b	517.13 ± 10.27^a	529.84 ± 14.12^a	521.62 ± 10.49^a	0.012
	GSH (nmol/mL)	384.51 ± 0.15	381.39 ± 0.14	385.66 ± 0.14	384.72 ± 0.18	0.845
	T-SOD (U/mL)	300.51 ± 20.04	315.44 ± 22.06	318.25 ± 19.78	307.53 ± 24.12	0.335
	CAT (U/mL)	142.32 ± 0.31^b	150.95 ± 0.33^a	156.13 ± 0.28^a	156.07 ± 0.36^a	0.042

Note: MDA, malondialdehyde; T-AOC, total antioxidant capacity; GSH-Px, glutathione peroxidase; T-SOD, total superoxide dismutase; CAT, catalase.

^abc Different superscript letters indicate significant differences (p < 0.05).

3.6. Antioxidant genes mRNA expression levels

The expression of Nrf2 signalling pathway related genes was determined in drumstick muscle tissues and presented in Table 9. Dietary supplementation with 500 mg/kg resveratrol significantly increased (p < 0.05) the mRNA expression level of Nrf2 gene when compared with that of other groups. In addition, the mRNA expression level of Keap1 gene was significantly reduced (p < 0.05) in these three dietary resveratrol supplementation groups when compared with that of basal diet group. Furthermore, compared with the basal diet group, both HO-1and GPX genes exhibited higher (p < 0.01) mRNA expression levels in all dietary resveratrol supplementation groups. Dietary supplementation with 500 mg/kg resveratrol induced a higher (p < 0.05) CAT gene expression level than that of the basal diet and 250 mg/kg resveratrol treatment groups. However, the expression levels of GST and NQO1 genes were not significantly different (p > 0.05) among these four groups.

Table 9. Effect of dietary resveratrol supplementation on the mRNA expression of antioxidant genes in drumstick muscle tissues of Chinese indigenous chickens.

Gene	Resveratrol (mg/kg)				p-value
	0	250	500	1000
Nrf2	1.00 ± 0.08^b	1.09 ± 0.06^b	1.18 ± 0.02^a	1.14 ± 0.03^ab	0.042
Keap1	1.00 ± 0.06^a	0.81 ± 0.02^b	0.79 ± 0.04^b	0.84 ± 0.03^b	0.036
HO-1	1.00 ± 0.01 ^b	1.07 ± 0.02^a	1.10 ± 0.04^a	1.09 ± 0.01^a	<0.001
GPX	1.00 ± 0.02 ^b	1.12 ± 0.03^a	1.14 ± 0.06^a	1.12 ± 0.04^a	<0.001
GST	1.00 ± 0.05	0.97 ± 0.12	1.11 ± 0.08	1.07 ± 0.05	0.321
CAT	1.00 ± 0.04^b	1.04 ± 0.03^b	1.15 ± 0.03^a	1.12 ± 0.06^ab	0.039
NQO1	1.00 ± 0.06	1.07 ± 0.05	1.12 ± 0.07	1.09 ± 0.03	0.243

Note: Nrf2, NF-E2-related factor 2; Keap1, Kelch-like ECH-associated protein 1; HO-1, Haem oxygenase 1; GPX, Glutathione peroxidase; GST, glutathione S-transferase; CAT, Catalase; NQO1, NAD (P)H/quinone oxidoreductase 1.

^abc Different superscript letters indicate significant differences (p < 0.05).

4. Discussion

Chinese indigenous chickens account for considerable proportion of the total chicken production in China based on their desirable characteristics, such as special meat quality, disease and stress resistance (Jaturasitha et al. 2017). Previous studies have investigated that Chinese indigenous chickens produced meat of higher quality than commercial broilers, including higher IMF content, lower muscle fibre diameter and lower shear force (Guan et al. 2013). It is expected that the proportion of Chinese indigenous chickens will be further increased in broiler industry as the living standards improve. However, compared with commercial broilers, Chinese indigenous chickens have worse feed efficiency, lower breast and drumstick muscle yield, as well as higher abdominal fat percentage (Deng et al. 2022), which limit the meat production efficiency. Therefore, optimization of feed nutrients is an efficient strategy to enhance the meat production of Chinese indigenous chickens with a concomitant maintenance of their meat quality standards. It has been pointed out that dietary resveratrol supplementation plays crucial role in elevating growth and carcase performance, fortifying health and improving meat quality in broilers (Zhang et al. 2018) and ducks (Yu et al. 2021). However, the effect of dietary resveratrol supplementation on the production performance of Chinese indigenous chickens needed to be comprehensively evaluated.

Growth performance is a key economically relevant trait in both commercial and indigenous chickens as it largely determines meat production efficiency. Previous studies indicated that dietary resveratrol supplementation improved the growth performance of broilers under harsh environmental conditions. For instance, it has been reported that dietary supplementation at the level of 400 mg/kg with resveratrol can effectively improve the BW, ADG, ADFI and/or F/G ratio of poultry under heat stress (Wang et al. 2021), lipopolysaccharide (He et al. 2022) and/or transport stress (Zhang et al. 2017). A previous study also reported that dietary supplementation with 350 mg/kg resveratrol improved the ADG and decreased rectal temperature of broilers under heat stress (He et al. 2019). Similarly, in the present study, we detected that the BW, ADG and F/G were both improved by these three dietary resveratrol supplementation treatments (250, 500 and 1000 mg/kg) in indigenous chickens. Previous studies provided clues to explore the positive effects of resveratrol on growth performance. Resveratrol plays crucial role in improving intestinal development and health status and further promoting the digestion and absorption of nutrients through the elevation of the relative length of ileum and jejunal villus height (Wang et al. 2021). At the same time, it increases the abundance indices of intestinal microbiota, manipulates the composition of intestinal microbiota, promotes the metabolism of intestinal microbiota and up-regulates the levels of intestinal barrier proteins (claudin-1 and occludin) (Zhuang et al. 2021; Zhao et al. 2022a). Excitingly, our results in the present study demonstrated that indigenous chickens feed with 500 mg/kg resveratrol exhibited higher relative jejunum weight and longer relative jejunum length when compared with that fed the basal diet. Furthermore, the resveratrol also improved the growth performance by positively regulating serum metabolic parameters and alleviating tissue oxidative damage (He et al. 2019), as well as alleviating the multiple factors-induced inflammatory response in the plasma and the liver (Yang et al. 2021b). In this study, a series of serum parameters of indigenous chickens were beneficially regulated by the resveratrol supplementation, including TP, GLB, TC, LDL and ALP. Based on these above-mentioned clues, dietary resveratrol supplementation improved the indigenous chickens growth performance through multiple functional roles.

Compared with the commercial broilers, indigenous chickens exhibited worse carcase performances including higher abdominal fat rate and lower lean rate, which resulted in a lower economic performance. Interestingly, dietary resveratrol supplementation significantly increased the muscle rate of breast and drumstick, as well as reduced the abdominal fat rate. The resveratrol has been described as an anti-obesity nutrient in multiple animal models and humans through mimicking the effects of calorie restriction (Springer and Moco 2019). Resveratrol has been reported to promote fatty acid mobilization from white adipose tissue, and enhance fatty acid transport into mitochondria and eventual oxidation in muscle and liver through enhancing the activity of enzymes involved in lipid catabolism, which indicated that the resveratrol shifted energy metabolism to increase lipid oxidation (Gimeno-Mallench et al. 2019). Furthermore, the mRNA expression of genes related to fatty acids synthesis was also down-regulated by the resveratrol through activating the Fiaf signalling pathway (Qiao et al. 2014). The resveratrol is also considered as a promoting factor for muscle, since enhances both proliferation and differentiation of satellite cells, facilitates mitochondrial biogenesis in obese mice (Niu et al. 2021), and prevents high-fat diet-induced muscle atrophy in aged rats by reversing mitochondrial dysfunction and oxidative stress (Huang et al. 2019). These above-mentioned studies indicated that dietary resveratrol improved the carcase performance of indigenous chickens through enhancing lipid catabolism and promoting muscle generation.

Meat quality is defined as a comprehensive trait that is evaluated through multiple indexes including colour, pH, share force, drip loss, cooking loss, intramuscular fat content, etc. Although the meat quality of indigenous chickens has been maintained at a higher level than commercial broiler (Guan et al. 2013), our present study detected that dietary resveratrol supplementation improved the meat colour and shear force of the breast and drumstick muscles from indigenous chickens. Meat colour is an intuitive standard for accessing meat quality to affect the acceptance and purchase decisions of consumers, which is usually evaluated through L*, a* and b* values. It has been stated that dietary resveratrol supplementation enhanced the activity of antioxidant enzyme defensive systems (Jin et al. 2021), increased mitochondrial biogenesis and function (Zhang et al. 2018), as well as further protected the muscle from free radical attacks and reduced the myoglobin oxidation, thus improving the meat colour. Shear force is mainly used to evaluate the meat tenderness, which is affected by muscle fibre diameter and intramuscular fat content. Previous studies have reported that dietary resveratrol supplementation decreased the muscle diameter and cross-sectional area (Yu et al. 2021), and promoted muscle fibre type transformation from type II to type I (Zeng et al. 2020). In addition, resveratrol was reported to improve intramuscular fat content through increasing citrate synthase activity and muscle mitochondrial respiration on a fatty acid-derived substrate, which resulted in the promotion of intramuscular lipid anabolism (Timmers et al. 2011). Therefore, dietary resveratrol supplementation improved the meat quality of indigenous chickens in multiple ways.

Oxidative stress is considered as a crucial factor that diminishes growth performance and meat quality in broilers (Estevez 2015). The Nrf2 signalling pathway is a classic molecular mechanism to anti-oxidative stress in tissues and body. In response to stress, Nrf2 detached from Keap1 and translocates to the nucleus, where it heterodimerized with one of the small Maf proteins to further motivate and promote antioxidant transcription programme (Baird and Yamamoto 2020). Then, the Nrf2 regulates the expression levels of a series of antioxidant-related genes in the nucleus, including GPX, HO-1, CAT, GST, NQO1, etc. In multiple animal models, the resveratrol has been confirmed to elevate the activity of anti-oxidative enzymes through the Nrf2 signalling pathway. For example, dietary resveratrol supplementation increased the activities of GPX and GST and the mRNA level for Nrf2 and SOD1, as well as decreased the content of PC and the Keap1 mRNA level in the jejunum mucosa of broilers under heat stress (Wang et al. 2021). Furthermore, resveratrol has beneficial effects on the meat quality of broilers through improving the antioxidative capacity of muscle (Zhang et al. 2017, 2018). Similarly, in the present study, we also detected that dietary resveratrol supplementation significant elevated the activity of anti-oxidative enzymes and reduced the MDA content in serum and liver tissue of indigenous chickens. In addition, the resveratrol decreased the Keap1 mRNA expression, and enhanced the mRNA expression of Nrf2, HO-1, GPX and CAT genes. These above results suggested that resveratrol participates in improving growth performance, carcase characteristics and meat quality through activating the Nrf2 signalling pathway to enhance the antioxidant status of indigenous chickens.

5. Conclusions

In conclusion, the results from this study determined that dietary supplementation with 250–500 mg/kg resveratrol improved the growth performance, carcase characteristics and meat quality of Chinese indigenous chickens. The mechanism underlying these positive effects might be related to the activation of the Nrf2 signalling pathway. To the best of our knowledge, this study provided the first evidence that resveratrol could be used as a functional nutrient in improving the industry of Chinese indigenous chickens. However, further investigations are required to elucidate the effects and potential mechanisms of resveratrol on the performances of Chinese indigenous chicken.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Data availability statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.