Human umbilical cord mesenchymal stem cells suppress lung cancer via TLR4/NF-κB signalling pathway

Abstract

The present study investigated the inhibitory effect of human umbilical cord mesenchymal stem cells (hucMSCs) on the growth of lung cancer in mice and its relationship with the TLR4/NF-κB signalling pathway. A mouse model of Lewis lung cancer was constructed by inoculating mice with Lewis lung cancer cell suspension under the axilla. Twenty mice were randomly and evenly divided into experimental group and control group. The experimental group received a caudal vein injection of 1 × 10⁶ hucMSCs each week for two consecutive weeks, and the control group, an equal amount of saline at the same time. Two weeks after treatment with hucMSCs, the mice were sacrificed and the tumour volume and tumour weight were recorded. Enzyme-linked immunosorbent assay was used to determine the IL-1, IL-6 and TNF-α contents in lung cancer tissues; real-time polymerase chain reaction, to measure the level of mRNA; and Western blotting, to determine the protein expression. The results showed that injection of hucMSCs inhibited the growth of Lewis lung cancer tissues, reduced Lewis lung cancer tissue weight, enhanced thymus index, and suppressed inflammatory responses. hucMSCs inhibited the expression of inflammatory factors IL-1, IL-6 and TNF-α by activating TLR4/NF-κB signalling pathway, and facilitated the expression of Bax. Moreover, huMSCs induced the expression of apoptogenic factor Bax by activating TLR4/NF-κB signalling pathway, and inhibited the expression of antiapoptotic factor bcl-2. The present study demonstrates that hucMSCs reduce inflammatory responses by mediating TLR4/NF-κB signalling pathway, promote apoptosis of tumour cells, and inhibit tumour proliferation in mice with Lewis lung cancer.

Keywords:

• human umbilical cord mesenchymal stem cells
• lung cancer
• TLR4/NF-κB signalling pathway

Introduction

Lung cancer is a common malignant tumour in humans. At present, radiotherapy, chemotherapy and surgery are the main treatments for lung cancer, but the survival rate of lung cancer patients is still low [1]. In 2017, the 5-year overall survival rate for lung cancer in the United States was 18% [2]. In China, the 5-year overall survival rate of lung cancer in 2016 was only 15.6% [3]. Therefore, effective treatment of lung cancer and improvement of the survival rate of lung cancer patients are still major challenges.

A promising strategy that has raised hopes as a potential approach to combat different types of tumors is the application of mesenchymal stem cells (MSCs). MSCs are a class of cells originating in the mesoderm, including bone marrow MSCs and adipose MSCs, etc. Human umbilical cord MSCs (hucMSCs) are one of the important sources of MSCs [4,5], and they have strong proliferation and low immunity. Studies have reported that MSCs have homing effect on tumours such as glioma and ovarian cancer, and have anti-tumour effect on blood cancer and breast cancer [6,7]. Therefore, hucMSCs are expected to become an ideal vector for gene therapy and participate in targeted therapy of tumours.

An important aspect of cancer drug research is the elucidation of the underlying molecular mechanisms of action. Toll-like receptors (TLRs) is a family of transmembrane protein receptors, and TLR4 belongs to this family. The occurrence and development of tumours are closely related to chronic inflammation. It is reported that the TLR4/NF-κB signalling pathway plays an important role in inhibiting inflammation and tumorigenesis [8]. In the present study, we investigated the inhibitory effect of hucMSCs on the growth of lung cancer in mice and its relationship with the TLR4/NF-κB signalling pathway.

Materials and methods

Cells

Mouse Lewis lung cancer cells (LLC1; Guangzhou Jennio Biotech Co., Ltd., Guangzhou, China) were cultured in DMEM (Dulbecco's Modified Eagle's Medium) supplemented with 10% foetal bovine serum under 37 °C and 5% CO₂. When reaching 95% confluency, the cells were trypsinized and prepared into cell suspension with a density of 1 × 10⁵ cells/mL.

To prepare hucMSCs, matrix tissue mass of umbilical cord in full-term parturients was digested with collagenase IV, and the suspension was collected and centrifuged. The sediments were then digested with 0.05% trypsin and filtered. The filtrate containing cells were used for cell count. After this, the cells were cultured in serum-free and low-glucose DMEM under 37 °C and 5% CO₂. The hucMSCs of 3^rd–7^th passages were used in subsequent experiments.

Animals

Twenty SPF C57BL/6J mice were purchased from Nanjing Biomedical Research Institute of Nanjing University, and used in the present study, including 10 males and 10 females (age, 6 weeks; weight, 18–20 g). The mice were raised in SPF Animal Laboratory under 20–22 °C, 50–70% humidity and 12 h/12 h light and dark cycle. The mice had free access to food and water.

After 7 days of feeding, each mouse was inoculated with Lewis lung cancer cell suspension under the axilla (0.2 mL). Two weeks later, mice with visible transplanted tumours were included as successful Lewis lung cancer transplantation model mice. The mice were randomly and evenly divided into control group and experimental group. The experimental group received a caudal vein injection of 1 × 10⁶ hucMSCs each week in two consecutive weeks, day 0 being the day of the first injection. The control group received a caudal vein injection of an equal amount of saline at the same time: one in the first week and another one in the second week. After two weeks, the mice were sacrificed by cervical dislocation. After weighing each mouse, tumour and thymus tissues were excised and weighed. Thymus index was calculated by the equation: thymus index = thymus weight (g)/body weight (10 g). Diameter (d) of tumours was measured by vernier callipers to calculate the radius (r), and tumour volume (V) was calculated by equation: V (cm³) = (4/3)πr³. Tumour weight was directly measured by an electronic scale.

Ethics of experimentation

All animal experiments were conducted according to the ethical guidelines of Lishui People’s Hospital. All efforts were made to minimise animal suffering.

Enzyme-linked immunosorbent assay (ELISA)

The concentrations of interleukin (IL)-1, IL-6 and tumour necrosis factor alpha (TNF-α) in tumour tissues were determined by respective ELISA kits (Elabscience Biotechnology Co., Ltd, Wuhan, China).

Real-time polymerase chain reaction (RT-PCR)

RNA extraction kit was used for the extraction of RNA in tissues and cells. After reverse transcription for the synthesis of cDNA, RT-PCR was performed for quantification. The primers used for TLR4, NF-κB, Bax, Bcl-2, IL-1, IL-6, TNF-α and β-actin are shown in Table 1. The following amplification programme (Takara, Dalian, China; 7300 Fast Real-Time PCR System, Thermo Fisher Scientific, Waltham, MA, USA) was used: initial denaturisation at 95˚C for 30 s; 40 cycles of denaturation at 95˚C for 5 s, annealing at 60˚C for 31 s, and elongation at 72˚C for 45 s.

Table 1. Primer sequences for RT-PCR.

Target genes	Upstream primer sequences (5′-3′)	Downstream primer sequences (3′-5′)
TLR4	CATGGATCAGAAACTCAGCAAAGTC	CATGCCATGCCTTGTCTTCA
NF-κB	GAACGATAACCTTTGCAGGC	TTTCGATTCCGCTATGTGTG
Bax	CCCGAGAGGTCTTTTTCCGAG	CCAGCCCATGATGGTTCTGAT
bcl-2	GGTGGGGTCATGTGTGTGG	CGGTTCAGGTACTCAGTCATCC
IL-1	GAAGAAGAGCCC ATC CTCTG	TCATCTCGC AGCCTG TAGTG
IL-6	ACAACCACGGCCTTCCCTACTT	CACGATTTCCCAGAGAACATGTG
TNF-α	GCCAACGGCATGGATCTC	GCAGCCTTGTCCCTTGAAGAG
β-actin	TGCCGACAGGATGCAGAAG	GCTGATCCACATCTGCTGGAA

Western blotting

Tumour tissues were washed with phosphate-buffered saline, and lysed with tissue lysis buffer for extraction of total proteins. Polyacrylamide agarose gel electrophoresis was performed and the proteins were transferred onto PVDF (polyvinylidene difluoride) membrane. The membrane was incubated with TLR4 antibody (1:500; Abcam, Cambridge, UK), NF-κB antibody (1:1000; Abcam, Cambridge, UK), Bax antibody (1:1000; Abcam, Cambridge, UK), bcl-2 antibody (1:1000; Abcam, Cambridge, UK), and β-actin antibody (1:10,000; Abcam, Cambridge, UK) overnight. After washing with TBST (tris-buffered saline and Tween 20 buffer), the membrane was incubated with secondary antibody (Abcam, Cambridge, UK) at room temperature for 1 h. After washing with TBST again, the membrane was developed by ECL (enhanced chemiluminescence) in dark. The grayscales of protein bands were analysed using Image-J software. Relative expression levels of TLR4, NF-κB, Bax and bcl-2 proteins were calculated against β-actin.

Statistical analysis

The results were analysed using SPSS 22.0 statistical software (IBM, Armonk, NY, USA). The data were expressed as mean values with standard deviations (± SD). Comparison between two groups was carried out using Student’s t-test. Comparison of more than two groups was performed by one-way analysis of variance followed by Student–Newman–Keuls posthoc test. p < 0.05 indicated statistically significant differences.

Results and discussion

With the increase of environmental pollution and smoking, lung cancer has become the main cause of death from malignant tumours [9]. Clinical treatment for lung cancer is limited and the overall 5-year survival rate of lung cancer patients is less than 15% [10]. As a non-immunogenic cancer, lung cancer is resistant to the immune system [11]. The immune system protects the body from cancer by identifying cancer cells. Tumour microenvironment is a chronic inflammatory process, which can promote the occurrence and development of tumours. It is believed that continuous progression of inflammatory responses and activation of the body’s immune system are closely related to tumours [12].

Injection of hucMSCs inhibits the growth of Lewis lung cancer tissues in vivo

MSCs have strong self-renewal ability and the potential to differentiate into osteocytes, adipocytes, etc. In addition, MSCs have low immunogenicity and can inhibit inflammation, tissue damage and tumour development. Therefore, MSCs have broad prospects in clinical application. It is reported that hucMSCs reduce tumour volume [13]. Fat-derived MSCs can regulate the AKT signalling pathway, inhibit proliferation of hepatocellular carcinoma cells and promote apoptosis of hepatocellular carcinoma cells [14]. Moreover, hucMSCs can inhibit the proliferation of hepatocellular carcinoma HCCC-9810 cells through the IGF-1R/PI3K/AKT pathway [15]. These studies demonstrate that MSCs can inhibit the occurrence and development of tumours and have potential application value in the treatment of tumours. To examine the potential effect of hucMSCs on lung cancer tissue volume, the experimental group received a caudal vein injection of 1 × 10⁶ hucMSCs each week and the control group received an equal amount of saline at the end of week two after injection. The data showed that on days 0–14, the tumour volume in the experimental group was not different from that in the control group (p > 0.05 at all time points). From day 25 on, the tumour volume in the experimental group was significantly lower than that in the control group on each subsequent day (p < 0.05 at all time points) (Figure 1). The result suggests that injection of hucMSCs inhibits (slows down) the growth of Lewis lung cancer tissues in vivo.

Figure 1. Lewis lung tumour volumes in mouse model. Experimental group (n = 10) received caudal vein injection of 1 × 10⁶ hucMSCs each week for consecutive two weeks. Control group (n = 10) received caudal vein injection of equal amount of saline at the same time. *p < 0.05 compared with control group at the same time point.

Treatment with hucMSCs reduces Lewis lung cancer tissue weight and enhances thymus index of mice

To evaluate the tumour weight and thymus index in the two groups, the mice were sacrificed by cervical dislocation on day 28. The data showed that the tumour weight in the experimental group was significantly lower than that in the control group (p < 0.05), whereas the thymus index in the experimental group was significantly higher than that in the control group (p < 0.05) (Table 2). The result indicates that treatment with hucMSCs reduces Lewis lung cancer tissue weight and enhances thymus index of mice.

Table 2. Comparison of tumour weight and thymus index.

Groups	N	Tumour weight (g)	Thymus index (g/10 g)
Control	10	4.04 ± 0.10	0.0021 ± 0.00015
Experimental	10	3.03 ± 0.07*	0.0032 ± 0.00014*

Note: *p < 0.05 compared with control group.

Treatment with hucMSCs inhibits inflammatory responses in mice with Lewis lung cancer

To measure the contents of IL-1, IL-6 and TNF-α, ELISA was performed. The data showed that the contents of IL-1, IL-6 and TNF-α in tumour tissues from the experimental group were significantly lower than those from the control group, respectively (p < 0.05 for all) (Figure 2). The result indicates that treatment with hucMSCs inhibits inflammatory responses in mice with Lewis lung cancer.

Figure 2. Contents of inflammatory factors IL-1, IL-6 and TNF-α in tumour tissues from mice. Experimental group (n = 10) received caudal vein injection of 1 × 10⁶ hucMSCs each week for consecutive two weeks. Control group (n = 10) received caudal vein injection of equal amount of saline at the same time. ELISA was used to determine IL-1, IL-6 and TNF-α contents in lung cancer tissues. *p < 0.05.

hucMSCs inhibit the expression of inflammatory factors IL-1, IL-6 and TNF-α by activating TLR4/NF-κB signalling pathway, and facilitate the expression of Bax mRNA

TLRs play important roles in innate immune system, and activate the immune system by identifying specific molecules. TLRs can recognise endogenous and exogenous ligands. TLR4 mainly depends on MyD88 pathway to activate downstream NF-κB phosphorylation, leading to increased release of inflammatory factors such as IL-1, IL-6 and TNF-α. TLR4 is widely expressed in lung cells, bone marrow and infiltrating cells. TLR1-6 and TLR9 are highly expressed in airway epithelial cells [16–18]. The expression of TLR2, TLR4, TLR7/8 and TLR9 in lung cancer was significantly higher than that in normal lung [19,20]. Therefore, activation of the TLR4 pathway in the immune system may be a new strategy for cancer treatment. To determine the expression of mRNA, RT-PCR was carried out. The data showed that the Bax mRNA level in the experimental group was significantly higher than that in the control group (p < 0.05), whereas the levels of TLR4, NF-κB, bcl-2, IL-1, IL-6 and TNF-α mRNA in the tumor tissues from the experimental group were significantly lower than those in the control group (p < 0.05) (Figure 3). The results suggest that hucMSCs inhibit the expression of inflammatory factors IL-1, IL-6 and TNF-α by activating TLR4/NF-κB signalling pathway, and facilitate the expression of Bax mRNA.

Figure 3. Relative expression of TLR4, NF-κB, Bcl-2, Bax, IL-6, IL-1 and TNF-α mRNA in tumour tissues from mice. Experimental group (n = 10) received caudal vein injection of 1 × 10⁶ hucMSCs each week for consecutive two weeks. Control group (n = 10) received caudal vein injection of equal amount of saline at the same time. RT-PCR was used to measure the level of mRNA. *p < 0.05.

huMSCs induce the expression of apoptogenic factor Bax by activating TLR4/NF-κB signalling pathway, and inhibit the expression of antiapoptotic factor bcl-2

To determine the expression of proteins, Western blotting was employed. The data showed that the expression of Bcl-2, TLR4 and NF-κB proteins in the experimental group was significantly lower than that in the control group (p < 0.05), whereas Bax protein expression in the experimental group was significantly higher than that in control group (p < 0.05) (Figure 4). This result indicates that huMSCs induce the expression of apoptogenic factor Bax by activating TLR4/NF-κB signalling pathway, and inhibit the expression of antiapoptotic factor bcl-2.

Figure 4. Relative expression of Bcl-2, Bax, TLR4 and NF-κB proteins in tumour tissues from mice. Experimental group (n = 10) received caudal vein injection of 1 × 10⁶ hucMSCs each week for consecutive two weeks. Control group (n = 10) received caudal vein injection of equal amount of saline at the same time. Western blotting was used to determine protein expression. *p < 0.05.

Conclusions

The present study demonstrates that hucMSCs significantly inhibit the growth of lung cancer tumours, reduce tumour volume and mass, and decrease the expression of inflammatory factors in mice with Lewis lung cancer. Of note, hucMSCs reduce inflammatory responses by mediating the TLR4/NF-κB signalling pathway, promote expression of the apoptogenic factor Bax, and inhibit tumour proliferation in mice with Lewis lung cancer.

Author contributions

LL, JP, ZC and ZY contributed to the design of the study. LL, JP, XC, EG, CX and HZ performed the experiments. LL and JP analysed the data. LL, JP, ZC and ZY interpreted results and prepared the manuscript. The final version of the manuscript has been read and approved by all authors.

Ethical approval and consent to participate

All procedures performed in this study were approved by the Ethics Committee of Lishui People’s Hospital. Written informed consent was obtained from all patients or their families.

Consent for publication

Written informed consents for publication of any associated data and accompanying images were obtained from all patients or their parents, guardians or next of kin.

Acknowledgements

The authors wish to thank their department and research team for their help and dedication.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Additional information

Funding

This work was supported by the Subject Fund of Zhejiang Province Science and Technology Hall (No. LGF19H010006) and Lishui Science and Technology Bureau Project (No. 2016GYX29).