Campylobacter infections among Bulgarian children: molecular characterization and antimicrobial susceptibility

Abstract

Infections caused by Campylobacter spp. continue to be a serious health burden worldwide. The importance of Campylobacter jejuni/coli for the development of acute gastroenteritis in Bulgaria has not been studied well yet, especially in early childhood. In this study, we report the incidence and the course of infection with C. jejuni/coli in early childhood and the antibiotic resistance of the clinical isolates tested. Bacteriological examination, followed by Multiplex polymerase chain reaction (PCR), was used. A total of 139 isolates of Campylobacter spp. were obtained from 368 fecal samples from children aged 0–5 years. The C. jejuni strains were 122 (87.8%), and C. coli strains 17 (12.2%). Antibiotic resistance was determined using disc diffusion tests. Resistance to tetracycline (38.1%) and ciprofloxacin (22.1%) was observed, as well as co-resistance to both antibiotics (15.1%). There is a relatively high incidence of campylobacteriosis in hospitalized children with diarrhea. The increasing resistance to quinolone and non-quinolone antibiotics is of concern.

Keywords:

• Campylobacter
• diarrhea
• gastroenteritis
• antimicrobial resistance

Introduction

Bacterial gastroenteritis caused by thermophilic Campylobacter spp. is considered a global health problem in humans and animals [1,2]. According to the European Center for Disease Prevention and Control (ECDC) and the Centers for Disease Control (CDC) in the United States, the most common causes of human campylobacteriosis are Campylobacter jejuni and C. coli, especially in children under 5 years of age [3,4]. The list of potential sources of infection with Campylobacter spp. includes consumption of contaminated milk, water, undercooked chicken and contact with pets. [1–5]. In addition to acute gastroenteritis, this pathogen has been associated with severe post-infectious complications such as Guillain-Barré syndrome, Henoch-Schonlein purpura, and other autoimmune conditions [1,6]. In recent years, the incidence of campylobacteriosis has increased significantly, but it is still rarely reported officially in Bulgaria [7]. According to the ECDC data for 2018, within the European Union, the incidence is highest in Germany with over 67,500 cases and in the Czech Republic with over 22,800 cases, while in Bulgaria only 191 cases were reported [8,9]. In contrast to Germany, where adults (25–60 years) are mostly affected, in Bulgaria the cases are most commonly reported in children under 5 years of age [7,10]. In a three-year study in Northern Poland, among 1030 children under 5 years of age, 99 (9.6%) tested positive for Campylobacter spp., with C. jejuni prevailing more than 10 times over C. coli [11]. About 0.8 million cases of campylobacteriosis are reported annually in the United States [12]. Among children in developing countries, the incidence of Campylobacter infection is thought to be even higher. Studies of children with acute gastroenteritis in Southeast Asia demonstrate an incidence of Campylobacter spp. from 3% to 15% [13].

In Bulgaria, testing for Campylobacter in patients with diarrhea syndrome has not yet been introduced as a routine procedure due to the labour-intensive isolation techniques. Therefore, there are no systematic data on the prevalence of campylobacteriosis in Bulgaria. A few retrospective studies show that Campylobacter spp. is one of the leading causes of diarrheal diseases, and that children are most affected [7]. In our previous prospective study, we also found a relatively high incidence of campylobacteriosis. Of the 520 children with diarrhea that were followed-up, 182 (35%) were diagnosed with campylobacteriosis [14].

There is a significant increase in the number of resistant isolates of Campylobacter spp. in recent years, and this is the reason for failures of treatment. Antimicrobial resistance to macrolides is still relatively low in the United States and Europe, mainly with respect to C. jejuni. In C. coli, substitutions in the 23S rRNA gene are relatively common, which results in macrolide resistance [15]. Studies in children in the United States demonstrated high resistance of Campylobacter spp. to ciprofloxacin (77.4%), while the resistance to azithromycin was 4.9% [12]. Increased resistance to tetracycline, which is most commonly associated with its overuse in ruminants, is also a global problem [16]. In our study, we monitored the incidence and clinical course of campylobacteriosis in hospitalized children with diarrhea syndrome and described the antibiotic resistance of the studied isolates.

Subjects and methods

Ethics statement

The study was conducted in accordance with the Declaration of Helsinki 2000 and was approved by the Ethics Committee of the University Hospital ‘Prof. Iv. Kirov’.

Samples

For a two-year period, 2018–2019, a total of 368 children hospitalized with acute diarrhea, aged 0–5 years (mean age 2.4 years) at the University Hospital ‘Prof. Iv. Kirov’ (Sofia, Bulgaria) were included in this study. A total of 368 fecal samples were examined at the National Reference Laboratory (NRL) of Enteric Infections, Pathogenic Cocci and Diphtheria at the National Center of Infectious and Parasitic Diseases in Sofia, Bulgaria, to isolate and identify Campylobacter spp. by culturing, biochemical and molecular methods.

Campylobacter detection

The presence of Campylobacter antigen was prospectively tested by Enzyme immunochromatographic assay (EIA) (CerTest, Spain) at the clinic, immediately after defecation.

Bacteriological examination

At the NRL, each EIA-positive fecal sample was cultured and all strains obtained were identified using Multiplex polymerase chain reaction (PCR). Multiplex PCR assay was used to detect conservative genes: the cadF (16SpDNA) gene, which is typical of Campylobacter spp.; hipO, the hippuricase gene characteristic of C. jejuni; and asp, the aspartokinase gene characteristic of C. coli. The primers we used and their sequences are shown in Table 1 [18,19].

Table 1. Sequences of the used primers and their amplicon sizes.

Gene	Sequence	Amplicon size (bp)	Reference
cadF-F	TTGAAGGTAATTTAGATATG	400	Nayak et al., 2005 [18]
cadF-R	CTAATACCTAAAGTTGAAAC
hipO-F	GAAGAGGGTTTGGGTGGTG	735	Linton et al., 1997 [19]
hipO-R	AGCTAGCTTCGCARAATAACTTG
asp-F	GGTATGATTTCTACAAAGCGAG	500	Linton et al., 1997 [19]
asp-R	ATAAAAGACTATCGTCGCGTG

We also included two reference strains: 814 (C. coli) and ATCC 33560 (C. jejuni) as positive controls for the PCR analysis and ddH₂O as a negative control. The multiplex PCR assay was optimized to function in a final reaction volume of 25 μL with these primers and under these conditions: 1× Taq DNA polymerase buffer; 4 mmol/L MgCl₂; 0.2 mmol/L dNTPs; 0.03 U/μL Superhot Taq DNA polymerase (set Applichem GmbH, Germany); 0.6 μmol/L cadF-F/R; 0.2 μmol/L asp-F/R; 0.2 μmol/L hipO-F/R. The assay was performed using an IQ5TM Real Time PCR System (BIO RAD) under the following cycling conditions: initialization step – denaturation at 94 °C for 5 min; then 35 cycles with denaturation at 94 °C for 45 s each, hybridization at 52 °C for 45 s and elongation at 72 °C for 60 s; the final step was elongation at 72 °C for 2 min. The sizes of the produced amplicons were 735 bp, 500 bp and 400 bp belonging to Campylobacter spp., C. coli and C. jejuni, respectively. The amplicons were visualized using capillary electrophoresis (QIAxcel, DNA QIAGEN sample Handbook, and Assay Technologies, 2008).

Antimicrobial susceptibility screening

The antimicrobial susceptibility of the confirmed Campylobacter isolates was tested by the disk diffusion tests in compliance with EUCAST, 2017, for tetracycline (TE, 30 µg), ciprofloxacin (CIP, 5 µg), erythromycin (E, 15 µg) and azithromycin (AZM, 15 µg). The four tested antimicrobial agents are most commonly used in Bulgaria for the treatment of Campylobacter infections.

Data analysis

Statistical analysis was performed using Independent Samples t-test and p < 0.05 indicated statistically significant differences. The results were analyzed using SPSS–19 software.

Results and discussion

Among 368 clinical fecal samples, 139 (37.77%) isolates belonging to Campylobacter spp. were obtained using bacteriological examination, followed by Multiplex PCR. Of all isolates, 122 (87.77%) belonged to C. jejuni and 17 (12.23%) to C. coli. The distribution of campylobacteriosis is presented in Table 2.

Table 2. Distribution of campylobacteriosis among pediatric patients in Sofia.

Year	Campylobacter spp.	C. jejuni	C. coli	Faecal samples	Campylobacter positive		p value
					male	female
2018	66	59	7	175	43	23	p < 0.05
2019	73	63	10	193	46	27	p < 0.05
Total	139	122	17	368	89	50	p < 0.05
		87.77%	12.23%		64.03%	35.97%

The age distribution of patients showed that campylobacteriosis was more common in older children (Table 3). Among children aged 0–5 months, it occurred in 18/139 (12.9%) only, while in the group aged 3–5 years, the incidence was 50/139 (35.9%) and the differences were statistically significant (p < 0.05). This is probably due to the gradual transition to a more varied diet in older children. The distribution of C. jejuni and C. coli among the different age groups was relatively uniform. Higher incidence of infections was observed in males, with statistically significant differences (p < 0.05) (Table 2). We obtained similar results in our other studies, and found similar reports in our available literature, but without particular explanation [7,14,20,21].

Table 3. Distribution of patients with campylobacteriosis by age.

Age of patients	Campylobacter spp.	p-value	C. jejuni	C. coli
0–5 months	18 (12.9%)	P < 0.05	17 (12.2%)	1 (0.7%)
6–11 months	32 (23%)		28 (20.1%)	4 (2.8%)
1–2 years	39 (28%)		36 (25.8%)	3 (2.1%)
3–5 years	50 (35.9%)	P < 0.05	41 (29.5%)	9 (6.5%)

The main clinical signs were diarrhea and fever (in all of the patients). In over 85% of children, blood admixtures were present in the diarrhea stool. In older children, the incidence of bloody diarrhea was higher, but this was not statistically significant (p > 0.05). Abdominal pain occurred mainly in children over three years of age (94.1%), probably because this is a subjective symptom. The difference vs. the younger children was statistically significant (p < 0.05). Vomiting occurred in about 1/3 of patients, and it was least common in the youngest (14.3%), probably due to easier feeding in breastfed infants. The differences were statistically significant (p < 0.05). Most of the hospitalized children, regardless of their age, showed a significant degree of dehydration (Table 4). Children with a lower degree of dehydration are generally treated in an outpatient setting and campylobacteriosis remains etiologically unspecified [7,14]. In our studies, we did not find statistically significant differences in the course of infections with C. jejuni and C. coli.

Table 4. Clinical symptoms in children by age groups.

Symptoms	0–11 months n = 21	1–3 years n = 34	Over 3 years n = 84	p value
Diarrhea	21 (100%)	34 (100%)	84 (100%)
Bloody diarrhea	18 (85.7%)	30 (88.2%)	76 (90.5%)
Abdominal pain	8 (38.1%)	21 (61.8%)	79 (94.1%)	p < 0.05
Vomiting	3 (14.3%)	11 (32.3%)	25 (29.8%)	p < 0.05
Fever	21 (100%)	34 (100%)	83 (98.8%)
Dehydration	20 (95.2%)	30 (88.2%)	66 (78.6%)

The emergence of antimicrobial-resistant Campylobacter strains is a growing concern worldwide [8,13]. Significantly increased resistance to tetracycline has been observed in Campylobacter isolates from cattle and chickens due to the fact that this antibiotic is often used as a growth factor [19,22,23].

In both Campylobacter species, high susceptibility to tetracycline was found (C. jejuni 38.13% and C. coli 41.18%). In C. jejuni, 21.3% resistance to ciprofloxacin was also found. None of the isolates showed resistance to erythromycin or azithromycin. Co-resistance to two antibiotics, tetracycline and ciprofloxacin, was observed in 21 (17.2%) of C. jejuni isolates.

According to the European Food Safety Authority (EFSA), extremely high levels of resistance of C. jejuni to ciprofloxacin (50–70%) were reported in 19 EU countries in 2017 [16]. Even higher levels of resistance were observed in C. coli (80–100%). Owing to the growing trend of resistance of C. coli to quinolones, ciprofloxacin is considered unsuitable for routine empirical treatment of campylobacteriosis in some countries [9,12]. Overall, the proportion of C. jejuni resistant to erythromycin remains low in the EU (about 2%), in contrast to the proportion of C. coli, which reaches 12–20% [9]. High resistance to tetracycline has traditionally been reported globally and in Europe. Tests of C. jejuni isolates obtained from humans from 19 countries in the EU found resistance of about 45% in C. jejuni and almost 69% in C. coli [9,12]. In our study, there was high resistance to quinolones (ciprofloxacin) and non-quinolone antibiotics (tetracycline). In Bulgaria, a previous study in children in 2003 found serious levels of resistance to tetracycline (24.4%) and ciprofloxacin (22.2%) [24]. This means that the resistance of Campylobacter spp. to tetracycline has increased by more than 10% in 15 years. The relatively high co-resistance of some strains of C. jejuni to tetracycline/ciprofloxacin is also noteworthy due to their clinical importance in the treatment of severe infections [17]. Such co-resistant strains have been described in broilers in Belgium, Denmark and Canada [2,13]. In Switzerland and Croatia, their incidence in people with acute gastroenteritis reaches 10-25% [8,9,25]. Our study places Bulgaria among the European countries with high co-resistance of C. jejuni to tetracycline/ciprofloxacin (Table 5). The best approach for our country is the use of macrolides and only in severe forms. Mild forms of campylobacteriosis should be considered as a self-limiting infection.

Table 5. Profiles of antimicrobial resistant C. jejuni and C. coli isolates recovered from clinical faecal samples.

Antibiotic concentration (µg)	Resistant strains		Total n = 139
	C. jejuni (n = 122)	C. coli (n = 17)
Tetracycline (30 µg)	46 (37.70%)	7 (41.18%)	53 (38.13%)
Ciprofloxacin (5 µg)	27 (22.13%)	–	27 (22.13%)
Erythromycin (15 µg)	–	–
Azithromycin (15 µg)	–	–
Cross-resistant to TE + CIP	21 (17.21%)		21 (15.10%)
Resistant to one antibiotic – TE	19 (9.83%)		19 (13.66%)
Resistant to one antibiotic – CIP	6 (4.55%)		6 (3.41%)

Conclusions

Although there is still not enough attention to the diagnosis and reporting of campylobacteriosis in Bulgaria, this study showed high incidence of this infection among children with diarrhea. As in the other countries in the EU and the USA, the infection with C. jejuni is most common, and less often C. coli is diagnosed. Although the findings of our study regarding the resistance of Campylobacter spp. to macrolides are optimistic, high resistance to ciprofloxacin and tetracycline is of concern, including the presence of co-resistant clinical isolates to both antibiotics. The treatment options for severe Campylobacter infections are becoming increasingly limited.

Disclosure statement

No potential conflict of interest was reported by the authors.

Additional information

Funding

This study was funded by the European Fund for regional development through Operational Program Science and Education for Smart Growth 2014 − 2020, Grant BG05M2OP001-1.002-0001-C04 ‘Fundamental Translational and Clinical Investigations on Infections and Immunity’.