Cloning and characterization of a phosphomevalonate kinase gene from Sanghuangporus baumii

Abstract

Sanghuangporus baumii, a macrofungus belonging to the Hymenochaetaceae family, has been widely used as a traditional medicine in Asia for centuries. Triterpenoids in S. baumii contribute to the pharmacological activities, however, their content is low in the fruiting body. Phosphomevalonate kinase (PMK) is an important rate-limiting enzyme in the triterpenoids synthesis pathway. In this study, a PMK gene (SbPMK) was cloned and analyzed. Sequence analysis showed that SbPMK has six exons and five introns. The 1,488 bp open reading frame encodes a 489 amino acid polypeptide with a predicted protein molecular weight of 52.47 kDa. The amino acid sequence of SbPMK shares highly similarity with that of PMK sequences from other species, especially in three functional motifs (MI, MII and MIII). The promoter of SbPMK contains typical cis-acting regulatory elements involved in MeJA responsiveness, light responsiveness, anaerobic induction, etc. Furthermore, recombinant SbPMK was overexpressed in Escherichia coli BL21, with a satisfactory solubility. During the fermentation culture of S. baumii, the biomass increased with fermentation and peaked on day 18 (4.80 g/L). The SbPMK expression and the triterpenoids content was peaked on day 6, and the triterpenoids content stabilized at 20.8 mg/g on day 18.

Supplemental data for this article is available online at https://doi.org/10.1080/13102818.2021.1938678 .

Keywords:

• Sanghuangporus baumii
• triterpenoids
• phosphomevalonate kinase
• prokaryotic expression

Introduction

Sanghuangporus baumii is a macrofungus that belongs to the Hymenochaetaceae family [1, 2]. It has been used as a traditional medicine for treating various diseases in China, Japan and some other Asian countries for centuries [3]. Triterpenoids are among the main bioactive components in S. baumii [4–7], and they are responsible for diverse pharmacological activities, including anti-tumour, anti-oxidative and anti-inflammatory properties [8–11]. Despite of these important pharmacological activities, the medical application of S. baumii triterpenoids is limited by the low yield of triterpenoids. Metabolic engineering is an effective way to increase the yield of triterpenoids in S. baumii. However, the lack of work on the biosynthetic pathway of S. baumii triterpenoids makes metabolic engineering difficult.

In eukaryotes, triterpenoids are synthesised via the mevalonate (MVA) pathway (Figure 1), in which mevalonate is converted through a series of chemical reactions to isopentenyl pyrophosphate, the building block of terpenoids [12–14]. This process requires the involvement of several enzymes, including phosphomevalonate kinase (PMK), an important rate-limiting enzyme. PMK catalyzes a reversible ATP-dependent phosphorylation, converting mevalonate 5-phosphate to mevalonate 5-diphosphate (Figure 2). As a representative kinase in the MVA pathway, the structure and function of PMK has been widely studied in human [15–17], bacteria [18], yeast [19] and plants [20]. Studies on the phosphorylation mechanism of Streptococcus pneumonia PMK indicate that PMK anchors ATP through a conserved serine residue (Ser106), and another serine residue (Ser213) located on the α-helix is responsible for facilitating the proton transfer [21]. In addition to the functional study of PMK, metabolic engineers found that the expression level of PMK was relatively low through the proteomics data, which may be a potential bottleneck in the MVA pathway. Hence, they significantly increased the expression levels of PMK and another protein, mevalonate kinase (MK), by optimizing the genes codon and using a stronger promoter, and increased the final diene titer by more than three times [22]. These studies suggest that PMK is the key to improve MVA pathway products through metabolic engineering. However, the literature contains very few studies on S. baumii PMK [23].

Figure 1. Sequence analysis of SbPMK and its promoter region. (A) Exon and intron sites of SbPMK. (B) Phylogenetic analysis of PMK from S. baumii and other species. (C) Functional elements of the SbPMK promoter.

Figure 2. Analysis of the secondary structure and predicted three-dimensional structure of SbPMK. (A) Annotation of the secondary structure of SbPMK. (B) Predicted three-dimensional structure of SbPMK. (C) Hydrophobicity analysis of SbPMK.

In this study, in order to explore the function of PMK in S. baumii, we cloned and analysed the structure of the SbPMK cDNA, DNA and promoter for the first time, and successfully expressed SbPMK in Escherichia coli. These studies will provide the basis for codon-optimization of the PMK gene and cognate promoter for metabolic engineering. Fermentation is an efficient method for triterpenoids production [24]. However, it remains unknown how the expression level of PMK affects the accumulation of S. baumii triterpenoids. Therefore, triterpenoids content and SbPMK transcript levels during fermentation of S. baumii were also measured.

Materials and methods

Strains and culture conditions

S. baumii strain was collected from Syringa reticulata at Yichun city, Heilongjiang Province, China, and identified based on internal transcribed spacer (ITS) sequence alignment in the National Center for Biotechnology Information (NCBI) database (GenBank accession number KP974834). Mycelia were cultured on potato-dextrose agar (PDA) plates to rejuvenate, then transferred to potato dextrose broth (PDB) medium and cultured in a constant temperature shaking incubator at 25 °C and 160 rpm to harvest mycelia. Escherichia coli DH5α and BL21 (DE3), both from TIANGEN (Beijing, China), were cultured on Luria-Bertani (LB) medium at 37 °C.

Nucleic acids isolation and cDNA preparation

Genomic DNA was extracted from the S. baumii mycelia using the cetyl trimethylammonium bromide (CTAB) method [25]. Total RNAs were extracted using TRIzol reagent (TaKaRa, Dalian, China) according to the manufacturer’s instructions, then treated with RNase-free DNase I (TaKaRa). Subsequently, a PrimeScript II 1st Strand cDNA Synthesis Kit (TaKaRa) was used to synthesise first-strand complementary DNA (cDNA).

Cloning and bioinformatics analysis

According to the annotation in the transcriptome of S. baumii mycelia, 1 putative phosphomevalonate kinase gene was obtained. Combining the genomic data of S. baumii present in the NCBI database (GenBank accession number: LNZH00000000), primers PMK-F and PMK-R (Table 1) were designed using Primer Premier 5.0 software (PREMIER Biosoft Co., Palo Alto, CA, USA). Using cDNA and Genomic DNA as a template, polymerase chain reaction (PCR) was performed to obtain the complete full-length cDNA and DNA sequence respectively. Specific primers were also designed to amplify the homologous promoter of SbPMK (promoter-F, promoter-R, Table 1). PCR products were purified and sequenced.

Table 1. List of primers used in the study.

Name	Sequence (5′-3′)
PMK-F	ACCACGACCATGAGCAGCTCTCAGGAT
PMK –R	AAAATTACACGGCATCTTTCAGCGCTT
promoter-F	GCATCTCACTCCGACTTATCCCA
promoter-R	AAGCAGAGACAACCGTCGCACT
PMK-B	CGCGGATCCATGAGCAGCTCTCAGGATACTTACG
PMK-X	CCGCTCGAGTTACACGGCATCTTTCAGCG
T7	TAATACGACTCACTATAGGG
T7t	GCTAGTTATTGCTCAGCGG
PMK-qF	AAGATTGAGCCATTCCAACTCCCAC
PMK-qR	GCAGCCTTATGCCACTTCAAAACTT
α-tubulin-F	CCAGCAAGCGTTACCGATT
α-tubulin-R	TCCACGACGTCCATCGTTC

Note. The underlined parts of PMK-B and PMK-X primers are respectively BamHI and XhoI restriction sites.

The open reading frame (ORF) was predicted with ORF Finder on the NCBI website (http://www.ncbi.nlm.nih.gov/orffinder/). The theoretic molecular weight, isoelectric point and absorption coefficient were predicted using ExPASy Proteomics Server (http://www.expasy.ch/tools/protparam.html). The protein domain structure was analysed using ExPASy PROSITE (http://www.expasy.ch/prosite/). Protein secondary structure was analysed with PSIPRED (http://bioinf.cs.ucl.ac.uk/psipred/). Transmembrane regions were predicted with TMHMM (http://www.cbs.dtu.dk/services/TMHMM/). The 3 D structure was predicted using SWISS-MODEL online homologous modelling software (http://swissmodel.expasy.org). The promoter was analyzed using PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/).

Phylogenetic analysis

Sequence similarity searches were performed using GenBank and the basic local alignment search tool (BLAST) algorithm (http://www.ncbi.nlm.nih.gov/blast) on the NCBI website, with the SbPMK sequence as a query. Homologous sequences were downloaded and aligned, and a neighbour-joining tree was constructed with MEGA 5.0 software [3]. The sequence was aligned using DNAMAN (Version 7) (Lynnon Corporation, Quebec, Canada).

Heterologous expression of SbPMK in E. coli

The entire SbPMK ORF was amplified using primers PMK-B and PMK-X harbouring BamHI and XhoI restriction sites, respectively (Table 1). Afterwards, the target fragment was incorporated into the pET-32a vector (TaKaRa), and transferred into E. coli DH5α competent cells for plasmid propagation. After propagation, recombinant plasmid pET-32a-SbPMK was transferred into E. coli BL21, and positive clones were screened by PCR using the vector primers T7 and T7t (Table 1). Individual E. coli BL21 colonies containing pET-32a-SbPMK were transferred into 5 mL LB medium and cultured to an optical density at 600 nm (OD 600) of 0.5–0.8, at which point isopropyl b-d-1-thioga-lactopyranoside (IPTG) was added to a final concentration of 1 mmol/L, and culturing was continued for 10 h. Samples (1 mL) were harvested every two hours during induction, centrifuged at 12,000 g for 10 min, and cells were re-suspended in 100 μL of 4× protein buffer (Solarbio, Beijing, China). Cells were subsequently disrupted using a boiling water bath for 10 min, centrifuged at 12,000 g for 5 min, and 7.5 μL of supernatant was analysed by 12% sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE).

Determination of biomass and triterpenoids

The strain was grown at 25 °C for 7 days in liquid PDB medium with shaking at 160 rpm. Fermentation was performed in PDB medium after inoculation with 5% (v/v) of the liquid culture. Mycelia were harvested at 3, 6, 9, 12, 15 and 18 days, followed by 45 °C of drying to a constant dry weight to obtain the biomass of mycelia. The dried mycelia were pulverized and extracted by 70% (v/v) ethanol (solid-liquid ratio 1:20) for 40 min at 60 °C. After removal of the mycelia by centrifugation, the supernatants were dried at 70 °C under vacuum conditions. Residues were added 4 mL 5% vanillin-acetic acid and 1 mL perchloric acid, incubated at 60 °C for 20 min, and cooled rapidly. Subsequently, 5 mL glacial acetic acid was added and incubated at room temperature for 15 min. The absorbance was detected at 546 nm in a spectrophotometer (Laspec, Shanghai, China). The content of triterpenoids was calculated according to a standard curve prepared by using ursolic acid [24].

SbPMK expression during fermentation

Fermentation was performed in 500 mL flasks containing 250 mL of PDB after inoculation with 5% (v/v) of the liquid culture. Mycelia were harvested at 3, 6, 9, 12, 15 and 18 days, and frozen at −80 °C until RNA extraction. Total RNA was extracted using TRIzol reagent, then reverse-transcribed to cDNA using a PrimeScript TM RT reagent Kit (TaKaRa) according to the manufacturer’s instructions. Primers PMK-qF and PMK-qR were used to evaluate levels of the SbPMK transcript, and α-tubulin was used as a reference gene (Table 1). Next, real-time quantitative reverse transcription–PCR was performed using an Mx3000P Sequence Detection System (Agilent Technologies, Santa Clara, CA, USA). Mycelia harvested at 0 days served as a reference, and relative transcript levels were calculated according to the 2^-ΔΔct method.

Data analysis

Quantitative data are presented as mean values from three independent experiments with standard deviation (±SD). Statistical analysis was performed using Tukey tests with STATGRAPHICS PLUS software (STATPOINT TECHNOLOGIES, INC., Virginia). Values were considered statistically significantly different at the p < 0.05 level.

Results

Gene sequence analysis

The gene fragment was cloned and sequenced. Protein BLAST search demonstrated that it encodes phosphomevalonate kinase, and belongs to the Isoprenoid_Biosyn_C1 Superfamily. Thus, it was designated as SbPMK. Comparison of the cDNA and DNA sequence revealed that the SbPMK gene contains six exons (nucleotides 1–263, 318–471, 526–1051, 1251–1450, 1540–1666, 1727–1944) and five introns (264–317, 472–525, 1052–1250, 1451–1539, 1667–1726; Figure 1(A)). The 1,488 bp ORF of SbPMK encodes a 495 amino acid polypeptide (Supplemental Figure S1) and shares 76.55% percent identity with the phosphomevalonate kinase of Fomitiporia mediterranea (Sequence ID: XP_007267080.1). The SbPMK sequence was deposited in GenBank under accession number MT040050.

Phylogenetic tree (Figure 1(B)) was constructed based on PMK sequences of 14 species (Table 2) of which 13 species belonged to Basidiomycota, and one species (Aspergillus luchuensis) belonged to Ascomycota. The basidiomycetes of phylogenetic trees are divided into three branches, Agaricales, Polyporales and Hymenochaetales, corresponding to the blue, dark green and red parts in Figure 1(B).

Table 2. Origins of homologous amino-acid sequences from other species.

Species	Accession ID	Kingdom
Polyporus brumalis	RDX50034	Polyporales; Polyporaceae
Polyporus arcularius	TFK87090	Polyporales; Polyporaceae
Lentinus tigrinus	RPD78369	Polyporales; Polyporaceae
Trametes versicolor	XP 008033662	Polyporales; Polyporaceae
Daedalea quercina	KZT70957	Polyporales; Daedalea
Wolfiporia cocos	AKA59152	Polyporales; Wolfiporia
Obba rivulosa	OCH85802	Polyporales; Gelatoporiaceae
Dendrothele bispora	THV05033	Agaricales; incertae sedis
Hypsizygus marmoreus	RDB16968	Agaricales; Lyophyllaceae
Schizopora paradoxa	KLO19480	Hymenochaetales; Schizoporaceae
Pyrrhoderma noxium	PAV19036	Hymenochaetales; Hymenochaetaceae
Sanghuangporus baumii	MT049950	Hymenochaetales; Hymenochaetaceae
Fomitiporia mediterranea	XP 007267080	Hymenochaetales; Hymenochaetaceae
Aspergillus luchuensis	GAT19361	Eurotiales; Aspergillaceae Ascomycota

Promoter analysis

The 1,806 bp SbPMK promoter contains typical eukaryotic promoter elements, including 20 CAAT-boxes (common cis-acting element in promoter and enhancer regions), 5 TATA boxes (with a core promoter element 30-bp upstream of the transcription start site), 8 G-boxes (cis-acting regulatory element involved in light responsiveness), 7 ABRE (cis-acting element involved in the abscisic acid responsiveness), 10 CGTCA-motif (cis-acting regulatory element involved in the MeJA-responsiveness), 1 ARE (cis-acting regulatory element essential for the anaerobic induction), 1 MBS (MYB binding site involved in drought-inducibility), 1 CAT-box (cis-acting regulatory element related to meristem expression) (Figure 1(C)).

Protein sequence analysis

The predicted molecular weight of the SbPMK protein is 52.47 kDa for the molecular formula C₂₃₅₂H₃₇₄₀N₆₂₆O₇₁₄S₈. The theoretical isoelectric point of the protein is 5.77, with 52 negatively charged residues (Asp + Glu) and 43 positively charged residues (Arg + Lys). The instability index of the protein is 45.10, classifying the protein as stable. The SbPMK does not contain transmembrane region (Supplemental Figure S1) and signal peptides (Supplemental Figure S2), indicating that it is synthesized on free ribosomes and retained in the cytoplasmic matrix for catalysis, which is consistent with the current state of knowledge [26].

Secondary structure analysis predicted that the SbPMK contains 42.63% alpha helix, 41.41% random coil, 11.72% extended strand and 4.24% beta region (Figure 2(A)). The predicted three-dimensional structure of SbPMK is shown in Figure 2(B). The grand average of hydropathicity (GRAVY) of SbPMK is 0.072 (Figure 2(C)), without obvious hydrophobic and hydrophilic regions. Comparison of PMK amino acid sequences from 14 species (Table 2) demonstrated that the sequences share high similarity, especially in the three functional motifs originally used to define the GHMP kinase superfamily (MI, MII and MIII, Figure 3). Of these, the most conserved MII has a Pro-X-X-Gly-Leu-X-Ser-Ser-Ala sequence that is folded into a phosphate-binding loop or P-loop for ATP binding [21].

Figure 3. Sequence alignment of the 14 amino acid sequences of PMK from the indicated species. Homology level was highlighted by shading in color: black for 100%, pink for ≥ 75% and blue for ≥ 50% identity. The three conserved functional motifs (MI, MII and MIII) are framed in red.

Heterologous expression of SbPMK in E. coli

E. coli BL21 was selected as a host to stably overexpress SbPMK. A clear protein band of the expected molecular weight (52.47 kDa + tag protein 22.68 kDa) was observed on the 12% SDS-PAGE gel (Figure 4), while no target protein was found in the control cells carrying empty plasmids. The results showed that SbPMK was successfully overexpressed in E. coli cells and the recombinant protein had satisfactory solubility.

Figure 4. Heterologous expression of SbPMK in E. coli following IPTG induction (1 mmol/L). The bands indicated by the red arrow are target proteins. Lane M, protein molecular weight marker (Solarbio, Beijing, China); Lane 1, blank control group: E. coli harbouring empty vector; Lane 2–7, E. coli harbouring pET-32a-SbPMK induced by IPTG at 0 h, 2 h, 4 h, 6 h, 8 h, 10 h.

Biomass during fermentation

The graph in Figure 5 displays the kinetics of mycelial growth during fermentation using PDB medium. The biomass increased slowly in the first 12 days, during which time the mycelia remained in a lag phase. After day 12, the mycelia entered a period of rapid growth, and the biomass doubled from day 12 to day 15. After day 15, the biomass kept increasing and reached the highest level of 4.80 g/L dry weight (DW) on day 18.

Figure 5. The biomass of mycelia during the fermentation of S. baumii.

SbPMK expression and triterpenoids content during fermentation

To determine the expression pattern of SbPMK during S. baumii fermentation, qRT-PCR was performed. Mycelia were harvested at different fermentation stages (3, 6, 9, 12, 15 and 18 days) for differential expression analysis. The α-tubulin gene served as a reference. The graph in Figure 6 displays the expression pattern of SbPMK during S. baumii fermentation. The SbPMK gene peaked on day 6 (1.82-fold higher than that on day 3), and decreased to the lowest expression on day 9 (0.46-fold). Bars in Figure 6 display triterpenoids content in unit mycelia during fermentation. The highest triterpenoids content was 27.48 mg/g (DW, dry weight) on day 6, and the lowest reached 19.63 mg/g (DW) on day 15.

Figure 6. Relative expression level of SbPMK and triterpenoid contents during S. baumii fermentation. The values with * are significantly different (p < 0.05).

Discussion

Triterpenes are a class of secondary metabolites with medicinal value, and their biosynthetic pathways have important clinical, pharmaceutical and biotechnology significance. Phosphomevalonate kinase is a key kinase in triterpenoids biosynthesis pathway. In this study, a PMK gene was cloned and analyzed from medicinal fungi S. baumii. Bioinformatics analysis identified SbPMK as a phosphomevalonate kinase that encoding a 495 amino acid polypeptide. Phylogenetic analysis revealed high similarity between SbPMK and the PMK sequences from other species, especially species belonging to Hymenochaetales. SbPMK share the closest relative with the PMK from the highly similar species Fomitiporia mediterranea, and the furthest relative with the PMK in A. luchuensis.

In addition to the common cis-acting elements, the homologous promoter of SbPMK also contains cis-acting regulatory elements involved in MeJA-responsiveness, etc. A large number of stress and hormone-related cis-elements were also observed in the promoter region of GHMP (Galactokinase, Homoserine kinase, Mevalonate kinase and Phosphomevalonate kinase) superfamily in wheat [27] and Arabidopsis [28]. These regulatory elements control the expression of genes in the MVA pathway in response to various hormones and stressors. In our previous studies, similar cis-regulatory elements were also found in the homologous promoters of the key enzyme genes of S. baumii’s MVA pathway, acetyl-CoA C-acetyltransferase synthase gene [29] and farnesyl pyrophosphate synthase gene [30]. Moreover, under the stimulation of MeJA, the content of triterpenoids in the mycelia of S. baumii increased by 4 times [31], which may be related to the MeJA-responsiveness elements in the promoters. Similarly, Ren et al. also reported that MeJA could induce the biosynthesis of ganoderic acid, a type of triterpenoid, through the transcriptional induction of genes in Ganoderma lucidum, which is consistent with our study [32].

The MVA pathway is an important conduit for the production of a wide array of bioactive substances. Heterologous expression of the MVA pathway in E. coli or yeast is used commercially to produce drugs, chemicals and fuels, including terpenoids [33–35]. The recombinant protein obtained in this experiment can be used to explore the kinetics of SbPMK, which is critical to optimize the pathway for high flux.

Submerged fermentation is an efficient method to produce biomass and bioactive metabolites. The medicinal mushrooms mycelia possess a number of medicinal properties such as anti-tumour, immunomodulatory, antigenotoxic, anti-inflammatory [36]. A number of triterpenoids were extracted and identified from the mycelia of S. sanghuang, a similar species of S. baumii [37]. Therefore, it is necessary to study the growth kinetics of mycelia in the fermentation process of S. baumii. During the submerged fermentation of S. baumii, the triterpenoids content fluctuated around 20 mg/g, indicating that the triterpenoids did not accumulate in the fermentation process. The transcription level of SbPMK also decreased after the peak on day 6 and remained at a lower level throughout the fermentation period. The similar trends of triterpenoids content and gene expression levels indicated that the low triterpenoids content was related to the low expression of SbPMK. In metabolic engineering, the low expression of PMK is considered to be a bottleneck in the pathway, limiting terpene production. Codon-optimization of the PMK gene and expression from a stronger promoter can significantly increase the kinase levels and corresponding terpene production [22].

Conclusions

In this study, a phosphomevalonate kinase gene and promoter were cloned and analyzed from medicinal fungi S. baumii. The SbPMK ORF encodes a 489 amino acid polypeptide and shares highly conserved functional domains with its orthologs in other species. The promoter of SbPMK contains cis-acting regulatory elements involved in MeJA-responsiveness, abscisic acid responsiveness, light responsiveness and anaerobic induction. These regulatory elements control the expression of genes in response to various hormonal and environmental stimuli. The SbPMK was synthesized in E. coli, which is helpful for studying the enzyme kinetics. During the fermentation of the mycelia of S. baumii, the expression of SbPMK and the content of triterpenoids were at a low level. It will be the next step to improve triterpenoids content through overexpression of SbPMK in S. baumii.

Data availability

All data that support the findings reported in this study are available from the corresponding author upon reasonable request.

Disclosure statement

No potential conflict of interest was reported by the authors.

Supplemental data

Supplemental data can be accessed at:

Additional information

Funding

This work was supported by the Fundamental Research Funds for the Central Universities, China (2572018AA05).