Metal-resistance encoding gene-fingerprints in some bacteria isolated from wastewaters of selected printeries in Ibadan, South-western Nigeria

Abstract

Several studies have reported the occurrence of metal-resistant bacteria and their genes in different wastewater, but there is a dearth of information on wastewater generated from printing operations as a probable source. This study aimed at fingerprinting metal-resistance encoding genes in bacteria recovered from wastewaters of selected printeries in Ibadan, Nigeria. Wastewaters from 10 selected printeries in Ibadan were collected monthly for 12 months. The metal composition of wastewater was determined using Atomic Absorption Spectrophotometry. Metal-resistant bacteria were isolated on metal-supplemented nutrient medium, and characterized using 16S rRNA gene sequencing. Metal-resistance genes were detected using specific primers and the presence of plasmids was determined using alkaline-lysis method. Forty metal-resistant bacteria belonging to six genera; Bacillus, Klebsiella, Pseudomonas, Citrobacter, Providencia and Proteus were identified. cusCBA, encoding resistance to copper and silver was detected in nine bacteria, while pbrA (encoding lead resistance) was detected in seven Pseudomonas aeruginosa isolates. chrA, encoding resistance to chromate ions, was detected in Proteus mirabilis PW3a and two isolates of Pseudomonas aeruginosa, while chrB was detected in Providencia vermicola PWAP₃ and Proteus mirabilis PW4c. Bacillus stratosphericus PW1b possessed the copper-resistance genes, pcoA and pcoR. Thirty-six bacteria (90%) of the total bacteria possessed plasmids larger than 10 Kb in size. In conclusion, wastewater generated from printing operations could be a potential source of metal-resistant bacteria and their genes.

KEYWORDS:

• Printing wastewater
• printeries
• metal-resistance genes
• metal-resistant bacteria
• plasmids
• Nigeria

1. Introduction

Printing and the processes associated with it occupy a pivotal position in everyday life as no day is complete without human beings having a direct or indirect contact with various forms of printed items. These items include packaged consumer products, books, newspapers, journal articles, computer prints, photocopies and a host of other products. Inks, the organic or inorganic pigments employed in printing process contain coloured and colourless pigment particles dispersed in suitable solvents [1]. Modern inks are very complex compounds in terms of their composition, as they contain along with pigments or dyes, other ingredients generally referred to as vehicles. These materials include: humectants (to control drying), pH modifiers, polymeric resins (for proper binding), anti-foaming agents to regulate foam efficiency, wetting agents such as surfactants (which control surface properties), biocides (to inhibit microbial growth) and thickeners (to control the application and flow of the ink) [2].

Wastewater discharged from printing processes and other related operations has been reported to contain potentially hazardous components such as residual chemicals, dyestuff, solvent residues, pigmented wiping materials, and some toxic heavy metals such as silver (Ag), copper (Cu), zinc (Zn), chromium (Cr), cadmium (Cd), lead (Pb), etc. Metals, apart from the naturally occurring ones, are products of anthropogenic activities such as chemical manufacturing, pigment and dye production, battery manufacturing, automobiles and petrochemicals. All these represent some of the major sources of input of metals into the environment [3]. Pigments used in printing operations, especially the inorganic pigments are usually metallic salts precipitated from solutions; in addition, the organic pigments also contain some metallic compounds in their chemical structures [4]. This makes it possible for bacteria in wastewater generated by printeries to develop metal resistance as a means of coping with the toxicity of metals in the wastewater. Thus wastewaters from printing operations are potential sources of metal-resistant bacteria. This feature notwithstanding has its application in the use of bacteria for metal clean up and bioremediation of metal-contaminated environments.

Although metal resistance has been widely studied in relation to industrial wastewater in Nigeria, none of the studies has investigated printing industry wastewater as a source of metal-resistant bacteria. In addition, no study has investigated the genes responsible for metal resistance in bacteria isolated from wastewater generated by printing industries. The objective of this study was to isolate metal-resistant bacteria from wastewater collected from small and medium scale printing industries in Ibadan, Southwestern Nigeria and assess the incidence of genes encoding resistance to metals in these bacteria.

2. Materials and methods

2.1. Study site

Wastewater samples were collected from 10 printeries located in Mokola, an area which is a hub for small and medium scale printing operations and the University of Ibadan printery, both located in Ibadan, Oyo State, Nigeria. The high concentration of printeries at Mokola was responsible for the selection of the area for sample collection. The University of Ibadan printery is located within the University of Ibadan premises. The printeries collect their wastewater in holding tanks which are emptied into a central drainage channel which connects the entire community to the Ogunpa River in Ibadan, Oyo state, Nigeria.

2.2. Wastewater sample collection

Wastewater samples were collected into pre-sterilized sample containers from the final effluent holding tanks of the printeries and transported in ice chests to the Environmental Microbiology and Biotechnology Laboratory, Department of Microbiology, University of Ibadan. Samples were analysed within six hours of collection.

2.3. Metal composition of printing press industry wastewater

The metal composition of selected printing wastewater was determined using the Atomic Absorption Spectrophotometer (AAS) (UNICAM 929, London Atomic Absorption Spectrophotometer powered by SOLAAR software). The wastewater samples were digested using the nitric acid method [5]. The digested filtrates were then analysed using the cathode lamp of each metal.

2.4. Isolation of bacteria from printing wastewater

Aliquots of serially diluted printing wastewater were plated on nutrient agar (Pronadisa Laboratorios Conda, SA) using the standard pour plate technique. Morphologically distinct colonies of bacteria growing on the plates were repeatedly streaked on fresh plates to obtain pure cultures which were stored in 15% glycerol stock at −80°C for further studies.

2.5. Minimum Inhibitory concentration (MIC) of the metals on bacteria

The isolated bacteria were subjected to increasing concentrations of selected metals on Mueller Hinton agar supplemented with filter-sterilized soluble salts of CuSO₄, PbNO₃, CdCl₂, K₂Cr₂O₇, AgNO₃ and ZnSO₄. The starting concentration for each metal was 50 μg/mL. The culture growing on the last concentration was transferred to the next higher concentration until the isolates failed to show visible growth. The Minimum Inhibitory Concentration (MIC) was taken as the lowest concentration of the metals that prevented the growth of the bacteria [6,7].

2.6. Identification of the metal-resistant bacteria

The isolates were identified using PCR amplification/sequencing of the 16S rRNA [8]. The PCR products were sequenced (Inqaba Biotech, South Africa) and the sequences were blasted against reference sequences in the GenBank for identification (http://www.ncbi.nlm.nih.gov/BLAST/). Extraction of the DNA was carried out using the ZR 96 Fungal/Bacterial DNA Kit (Zymo Research Corporation, USA). The sequences were submitted to the GenBank and accession numbers were assigned.

2.7. PCR amplification of metal-resistance genes/detection of plasmids

Metal-resistance encoding genes were amplified by PCR with primers targeting the chromium-zinc-cadmium resistance genes czcA, czcB, and czcD; silver resistance genes silCBA, agrCBA and cusCBA; copper resistance genes pcoA and pcoR; chromate resistance genes chrA and chrB, and lead resistance gene pbrA. The reaction mixture in each case contained 12.5 μL of Master Mix, 7.5 μL of PCR quality (Nuclease-free) water, 1.0 μL each of both forward and reverse primers and 3 μL of the DNA template. The annealing temperature for the PCR assays are as follows: 57°C (czcA, czcB, czcD, pcoA, pcoR, chrA and chrB), 55°C (silCBA, agrCBA and cusCBA) and 58°C (pbrA). All reactions included a negative (sterile water) control and a positive control where available. The oligonucleotide primers used in this study are shown in Table 1. Plasmid DNA was extracted from the bacteria using the alkaline-lysis method [9]. This was necessary because most of the genes targeted (unless stated otherwise) were plasmid-based. Plasmid sizes were determined by comparison with a DNA marker (Thermo Scientific).

Table 1. Oligonucleotide primers used in this study.

Target genes	Primer (Forward and Reverse)	Length of amplified region (bp)	Reference
pbrA	5′ATGAGCGAATGTGGCTCGAAG 3′	Approx 2400	[10]
	5′ TCATCGACGCAACAGCCTCAA 3′
czcA	5′ GTTTGAACGTATCATTAGTTTC 3′	1885	[11]
	5′ GTAGCCATCCGAAATATTCG 3′
czcB	5′ CTATTTCGAACAAACAAAAGG 3′	1520	[11]
	5′ CTTCAGAACAAAACTGTTGG 3′
czcD	5′ CAGGTCACTGACACGACCAT 3′	398	[11]
	5′ CATGCTGATGAGATTGATGATC 3′
chrA	5′ CTTATACGCTACGCCAACTG 3′	1292	[11]
	5′ GTAATGGCATTCAGTCGCTTG 3′
chrB	5′ GTCGTTAGCTTGCCAACATC 3′	450	[11]
	5′ CGgAAAGCAAGATGTCGATCG 3′
silCBA	5′ GGATCTTGCCACGAATCATATAGC 3′	3562	[12]
	5′ ACGTCAGCGTGGAGTTGATGTA 3′
agrCBA	5′ GCCGAAACACGACGTTCTACT 3′	3277	[12]
	5′ CCCAGGAGTGAGCTTCTCATTT 3′
cusCBA	5′ GATCTCTAGACGGAGGCTTTATGTCATTCC 3′	6413	[12]
	5′ GATCCTGCAGCAAACCATCCCGGTCGTC 3′
pcoR	5′ CAGGTCGTTACCTGCAGCAG 3′	636	[13,14]
	5′ CTCTGATCTCCAGGACATATC 3′
pcoA	5′ CGTCTCGACGAACTTTCCTG 3′	1791	[13,14]
	5′ GGACTTCACGAAACATTCCC 3′

3. Results

A total of 40 bacteria showing different levels of resistance to five selected metals were obtained. The 16S rRNA gene sequencing showed that the isolates belonged to six genera namely: Bacillus (18), Pseudomonas (11), Proteus (6), Klebsiella (2), Providencia (2) and Citrobacter (1) as shown in Figure 1.

Figure 1. Frequency of occurrence of metal-resistant bacteria from selected printeries.

Table 2 shows the mean metal concentration of wastewater obtained from 3 selected printeries of the 10 sampled. The copper concentration of the wastewater was highest for PPW1 and PPW2 (3.07 and 4.52 mg/L respectively), while zinc was highest in PPW3 (2.22 mg/L) in comparism to the other metals. The least concentration of metal was silver for all the wastewater sampled. In most of the cases, the metal concentrations were more than the National Environmental Regulations (NER) limit [15], except in few instances.

Table 2: Mean metal concentration of wastewater of three selected printeries (mg/L).

Metal	PPW1	PPW2	PPW3	NERS Limit
Cu	3.07 ± 0.03	4.52 ± 0.03	1.42 ± 0.00	0.5
Pb	4.12 ± 0.08	0.53 ± 0.01	0.15 ± 0.05	0.1
Zn	1.12 ± 0.03	4.08 ± 0.14	2.22 ± 0.01	2
Cr	1.31 ± 0.00	0.83 ± 0.02	0.13 ± 0.00	0.5
Cd	2.22 ± 0.03	1.44 ± 0.00	0.13 ± 0.03	0.02
Ag	0.0042 ± 0.00	0.0062 ± 0.00	0.0016 ± 0.00	-

Note: PPW: Printery wastewater, NERS: National Environmental Regulation Standard in Nigeria.

3.1. Minimum inhibitory concentration (MIC) of the metals on the bacteria

The bacteria showed varying degree of tolerance to the tested metals. Bacillus stratosphericus PW1b showed the highest level of tolerance to copper (Cu) with an MIC of (650 µg/mL), while the MIC for all the other bacteria ranged from 100 to 500 µg/mL. In the case of lead (Pb), 5 of the isolates were resistant at concentrations <500 µg/mL with the remaining having MIC values ranging from 500 to 550 µg/mL. At a concentration of 500 µg/mL, 37.5% (15) of the total bacteria obtained in this study were able to grow on zinc. However, the MIC range for zinc was between 100 and 400 µg/mL for the remaining isolates. Fourteen of the 40 metal-resistant bacteria, representing 35% were resistant to cadmium with MIC value of 500 µg/mL. With the exception of Proteus mirabilis PW4c (MIC: 0 µg/mL) and Pseudomonas aeruginosa PW5c (MIC: 450 µg/mL) all the other bacteria showed a MIC ranging between 100 and 400 µg/mL for cadmium. Twenty-six of the total bacteria (65%) grew in the presence of 400 µg/mL of silver, with the rest growing at MIC <400 µg/mL (Table 3).

Table 3: Minimum Inhibitory Concentration (MIC) of the metals on the bacteria (μg/mL), metal-resistance genes detected and presence of plasmids.

Bacterial isolate	Source	Pb	Zn	Cd	Cu	Cr	Ag	Metal-resistance genes detected	Plasmid	Accession Number
Bacillus aerius PW1a	PP1	500	500	400	500	200	400	cusCBA	Yes	MK026845
Klebsiella oxytoca PW1ay	PP1	500	500	400	500	400	400	NMGD	Yes	MK026847
Bacillus stratosphericus PW1b	PP1	250	100	100	650	100	100	cusCBA, pcoA, pcoR	Yes	MK026844
Pseudomonas japonica PW1c	PP1	500	100	300	400	100	400	NMGD	Yes	MK026846
Bacillus stratosphericus PW1e	PP1	500	200	500	500	500	400	NMGD	No	MK026849
Bacillus aerophilus PW2a	UIP	100	100	100	100	100	100	cusCBA	Yes	MK026850
Providencia vermicola PW2b	UIP	500	100	100	100	200	300	cusCBA	Yes	MK026875
Bacillus stratosphericus PW2bb	UIP	450	300	350	300	400	200	cusCBA	Yes	MK026843
Proteus mirabilis PW3a	PP2	500	500	300	200	400	300	chrA	Yes	MK123476
Bacillus aerophilus PW3c	PP2	500	100	100	100	100	400	cusCBA	Yes	MK026864
Pseudomonas aeruginosa PW3d	PP2	500	200	100	500	400	400	pbrA, chrA	Yes	MK123475
Klebsiella oxytoca PW4a	PP3	500	100	100	400	500	400	cusCBA	Yes	MK026848
Proteus mirabilis PW4b	PP3	500	100	200	100	400	400	NMGD	Yes	MK026861
Proteus mirabilis PW4c	PP3	500	100	NG	100	400	100	cusCBA, chrB	Yes	MK026860
Pseudomonas aeruginosa PW4d	PP3	500	400	500	400	100	100	pbrA	Yes	MK026858
Pseudomonas aeruginosa PW5a	PP4	500	400	500	200	100	NG	NMGD	Yes	MK026869
Bacillus cereus PW5b	PP4	550	400	400	500	400	400	NMGD	Yes	MK026856
Pseudomonas aeruginosa PW5c	PP4	350	300	450	350	450	200	pbrA, chrA	Yes	MK026867
Pseudomonas aeruginosa PW5d	PP4	500	400	500	400	100	100	pbrA	Yes	MK026853
Proteus mirabilis PW5e	PP4	500	400	400	500	NG	400	cusCBA	Yes	MK026870
Bacillus aerophilus PW5f	PP4	500	500	100	500	500	300	NMGD	Yes	MK026842
Bacillus thuringiensis PWA1	PP5	500	200	400	100	400	400	NMGD	Yes	MK026865
Proteus mirabilis PWA2	PP5	500	200	500	500	200	400	NMGD	Yes	MK026868
Bacillus cereus PWA3	PP5	500	500	300	500	400	400	NMGD	Yes	MK026877
Citrobacter freundii PWA4	PP5	100	100	100	100	100	-	NMGD	No	MK026871
Pseudomonas aeruginosa PWAP1	PP6	500	500	500	500	100	300	pbrA	Yes	MK026872
Bacillus cereus PWAP2	PP6	500	500	500	500	200	400	NMGD	Yes	MK123474
Providencia vermicola PWAP3	PP6	500	500	500	400	200	400	chrB	Yes	MK026862
Bacillus aerophilus PWN1A	PP7	500	500	400	500	200	400	NMGD	No	MK026857
Bacillus thuringiensis PWN1B	PP7	500	200	300	500	400	400	NMGD	No	MK026866
Bacillus subtilis PWN1C	PP7	500	500	500	500	200	400	NMGD	Yes	MK026874
Bacillus thuringiensis PWN2A	PP8	500	200	500	500	200	400	NMGD	Yes	MK026851
Bacillus thuringiensis PWN2B	PP8	500	500	500	500	500	400	NMGD	Yes	MK026873
Pseudomonas aeruginosa PWN2C	PP8	500	400	500	400	100	300	pbrA	Yes	MK026852
Bacillus thuringiensis PWN2D	PP8	500	500	300	500	500	400	NMGD	Yes	MK026854
Proteus mirabilis PWN3A	PP9	500	200	400	100	400	400	NMGD	Yes	MK026855
Bacillus cereus PWN3B	PP9	500	500	500	500	500	400	NMGD	Yes	MK026863
Pseudomonas aeruginosa PWN3D	PP9	500	500	500	500	200	400	pbrA	Yes	MK026876
Pseudomonas aeruginosa PWN3T	PP9	400	500	400	500	400	400	NMGD	Yes	MK026859
Pseudomonas aeruginosa PWN3Y	PP9	500	400	400	400	300	400	NMGD	Yes	MK026878

KEY: PP: Printery, UIP: University of Ibadan Printery, NG: No growth was observed after the incubation period, NMGD: No metal-resistance gene detected, Yes: Presence of plasmid, No: Absence of plasmid.

3.2. Detection of metal resistance genes and plasmid profile

The silver resistance genes, silCBA and agrCBA, and the chromium-zinc–copper resistance genes czcA, czcB and czcD were not detected in any of the isolates. However, copper resistance genes, pcoA and pcoR were both detected in Bacillus stratosphericus PW1b. chrA and chrB encoding chromium resistance were detected in three bacteria (Proteus mirabilis PW3a, Pseudomonas aeruginosa PW5c and Pseudomonas aeruginosa PW3d) and two bacteria (Providencia vermicola PWAP₃ and Proteus mirabilis PW4c) respectively. cusCBA was detected in nine isolates namely: Proteus mirabilis PW4c, Bacillus aerius PW1a, B. stratosphericus PW2bb, Bacillus aerophilus PW2a, Klebsiella oxytoca PW4a, Proteus mirabilis PW5e, Providencia vermicola PW2b, Bacillus aerophilus PW3c and Bacillus stratosphericus PW1b. pbrA was detected in seven Pseudomonas aeruginosa strains spread across the sampling sources. The plasmid profile showed that 36 of the 40 metal-resistant bacteria possessed plasmids with sizes larger than 10Kb (Figure 2).

Figure 2. Plasmid profile of selected metal-resistant bacteria on 0.8% agarose gel. Lanes represent the following: M: DNA marker (Thermo Scientific), N: Negative control, 1: B. cereus PW5b, 2: P. mirabilis PWN3A, 3: B. aerophilus PWN1A, 4: B. thuringiensis PWN2B, 5: B. stratosphericus PW1e, 6: B. cereus PWA3, 7: B. stratosphericus PW2bb, 8: B. subtilis PWN1C, 9: B. thuringiensis PWN1B, 10: P. aeruginosa PWAP1.

4. Discussion

Various genera of metal-resistant bacteria have been isolated from different sources notably wastewater. Several authors have reported the isolation of metal-resistant bacteria from various sources [7,16–18]. Bacteria adapt to metal stress in their environment and respond to it by developing several resistances or coping mechanisms to its toxicity [19]. This has made the study of bacteria in metal-contaminated environment an interesting one. Furthermore, the presence of metal contaminants in the immediate environment could also act as a precursor in the stimulation of resistance to metal species by bacteria. The printing press wastewater employed in this study had a considerable level of metal contaminants present, and this could have propelled the bacteria therein to develop adaptive features against those metals.

The cop resistance determinants which share a functional similarity with pco resistance determinants have been confirmed to be responsible for copper resistance in Pseudomonas syringae [20], whereas pco are responsible for copper resistance in Escherichia coli. In contrast however, other researchers reported that there is a slight difference in the mechanisms of action of cop- and pco- encoded copper resistance in bacteria. The cop genes are believed to encode the sequestration of copper and higher accumulation [21], whereas that encoded by pco is an energy-dependent export and lower accumulation of copper in the bacterial cell [22,23]. The proposed mechanism of copper resistance in Escherichia coli requires the cooperation of both the plasmid and chromosomal functions to initiate resistance in an integrated fashion [24]. Plasmid-mediated resistance to copper has been reported in several species of bacteria especially Pseudomonas syringae pv tomato and E. coli and documented by several authors [14,24–28]. On the contrary however, chromosomal resistance to copper has also been described in Enterococcus hirae [29,30]. This might be responsible for the phenotypic resistance to copper by some bacteria in this study, even without the possession of the copper resistance determinants.

The range of bacterial hosts in which the pco determinant could function, might be limited to those genera closely related to E. coli, such as Citrobacter, Salmonella, and Shigella, all Gram negative organisms. This is in sharp contrast with the findings from this study, in which Bacillus stratosphericus PW1b, a totally unrelated Gram positive organism, was found to possess the pco gene determinants. The presence of these genes in gram positive group of bacteria could be attributed to the plasmid-borne nature of the gene which might have broadened its host spectrum [24]. Though Chihomvu and his co-workers in 2015 in their study on Klip River in South Africa, reported the detection of the copper resistance gene, pcoA in Lysinibacillus sp. KR25, this study is the first report of the detection of pco genes in any Gram positive bacterium isolated from printing wastewater.

The chrBAC operon is a set of genes harboured by the pMOL28 plasmid of the multi-metal resistant Cupriavidus metallidurans CH3. chrA chromate resistance protein has been detected in strains of Pseudomonas aeruginosa [31]. Two Pseudomonas strains in this study were observed to possess the chrA gene; however Proteus mirabilis PW3a in this study was also detected to possess the same gene. Based on the literatures at our disposal, this is likely to be the first report of the detection of chrA gene in Proteus mirabilis especially from printing wastewater. In addition, it has been reported that bacterial resistance to chromium may be due to either chromosomal mutations [32] or plasmid-mediated [33,34]. The presence of plasmids encoding chromate resistance has also been reported in certain species of Pseudomonas, Alcaligenes, Salmonella, Bacillus and Escherichia coli by several authors [34–39]. In this present study, chrB which regulates the chrA transporter [40] was detected in Providencia vermicola PWAP3 and Proteus mirabilis PW4c and this corroborated the report on the possession of the chr operon on the plasmids of species of Gram negative bacteria [41]. The same authors also reported the detection of the genes in some Bacillus strains isolated from tannery effluent.

The CBA-transport systems which are involved in the export of metal ions, xenobiotics and drugs are exclusively found in Gram negative bacteria. The need for Gram negative cells to safeguard the cytoplasm and translocate metals and other toxicants across their outer membrane has necessitated this system. Contrary to this report however, the cusCBA was detected in some strains of bacteria that are not Gram negative in this study. Five of the seven bacteria possessing the cusCBA in this study were gram-positive, while the remaining belongs to the gram-negative genera. The 6413 bp gene was detected in Proteus mirabilis PW4c, Bacillus aerius PW1a, Bacillus stratosphericus PW2bb, Bacillus aerophilus PW2a, Klebsiella oxytoca PW4a, Proteus mirabilis PW5e, Providencia vermicola PW2b, Bacillus aerophilus PW3c, and Bacillus stratosphericus PW1b. The gene which has also been detected in Escherichia coli is also carried by the pMOL30 plasmid of the well-studied, multi-metal resistant Cupriavidus metallidurans CH34 [42,43].

All the Pseudomonas strains possessing the cusCBA in this present study showed varying resistance to copper and silver as outlined by their MIC to copper and silver ions; and this corroborates the report of some authors who opined that the cus determinant is induced by copper and silver, though the inducement by silver is to a lesser extent compared to copper [44–46]; Their findings were partly corroborated by other reports on the clear contribution of the cus to copper resistance under anaerobic condition [46], they went further to report that the detoxification of copper by the cus system occurred in an oxygen-rich atmosphere. Contrary to this however, it has been reported that the protein of the cus system only mediates resistance to silver and that the conferment of resistance to copper could not be ascertained, even when the copA which encodes the copper-detoxifying P-type ATPase was disrupted in a mutant background. They however showed in their finding that copper was a better inducer of the expression of cus than silver, suggesting a probable involvement of the genes in the resistance of bacteria to copper; as reported by other researchers [47,48].

The pbr proteins are a group of proteins encoded in the widely studied metal-resistant Cupriavidus metallidurans CH34, and they include; PbrT, PbrA, PbrB, PbrC, PbrD and PbrR. The pbrA, is a PIB-type ATPase in Cupriavidus metallidurans, and is the main lead efflux transporter [10]. The gene was detected in 7 of the 40 (17.5%) metal-resistant bacteria obtained in this study. The bacteria found to possess the pbrA gene were all strains of Pseudomonas aeruginosa. Strains of Pseudomonas marginalis and Bacillus megaterium have been observed to show extracellular lead exclusion and intracellular cytoplasmic lead accumulation respectively. Pb-resistant strains of other bacteria e.g. Staphylococcus aureus, Citrobacter freundii and Vibrio harveyi have also been reported [49–52].

Though it was initially thought that the Pbr efflux system was Pb(II) specific. The participation of the Pbr efflux in the protection of the cell wall against Cd (II) and Zn (II) has been reported [53]. The specific mechanisms of Pb(II) resistance require the mutual cooperation of pbrA and pbrB genes hence the two are majorly involved in mediating lead resistance in bacteria e.g. in the metal-resistant Cupriavidus metallidurans [10]. It should be stressed however that the functional roles of the other genes in the Pbr efflux system e.g. PbrT, PbrC and PbrD are still an issue of debate among researchers, because their absence does not in any way impair the ability of the system to neutralize toxic ions in Cupriavidus metallidurans [10,53] However from this present study, all the bacteria were able to tolerate different concentration of lead, even without the possession of the pbrA. This suggests that there might probably be other mechanisms of resistance to the metal possessed by the strains and the possibility of the resistance being chromosome-mediated or being mediated by other gene variants.

Conclusion

This study has highlighted printing industries in Ibadan, Nigeria as a potential contributor of metal-resistant bacteria and their genes into the environment, highlighting an urgent need for the enforcement of regulations regarding wastewater discharge, especially in developing countries of the world where wastewater from the manufacturing sector is discharged into the environment without prior treatment.

Acknowledgements

The authors are also grateful to the University of Fort Hare for providing the platform for the molecular component of this study.

Disclosure statement

No potential conflict of interest was reported by the authors.

ORCID

Abimbola O. Adekanmbi http://orcid.org/0000-0002-2871-1002

Olawale O. Adelowo http://orcid.org/0000-0002-5235-8122

Additional information

Funding

The authors are grateful to the Tertiary Education Trust Fund (TETFUND) in Nigeria for the grant given to the first author under the Academic Staff Training and Development (AST&D) scheme and to the South African Medical Research Council (SAMRC) for financial support.