Ranque–Hilsch Vortex Tube Thermocycler for DNA Amplification

Abstract

An innovative polymerase chain reaction (PCR) thermocycler using pressurized gas through a Ranque–Hilsch vortex tube is described below. This device can amplify 10 pg of 186 bp Escherichia coli uidA amplicon in a 20 µL sample 3.3 × 10⁸‐fold, by performing 35 cycles in less than 8 min. This PCR amplification corresponds to an overall efficiency of 75%.

Keywords:

• DNA amplification
• Thermocycles
• PCR method
• Reaction time

Acknowledgment

Financial support for this study from ARO under the supervision of Dr. James Gillespie is gratefully acknowledged.

Notes

^aTwo sets of primers uidA 1047 (5′‐TATGAACTGTGCGTCACAGCC‐3′) and UidA 1232 (5′‐CCATCAGCACGTTATCGAATCC‐3′) were used to amplify 186 bp amplicon from the gene encoding β‐glucuronidase of E. coli. The 20 µL PCR reaction mixture consisted of 200 µM dNTPs, 400 µg/mL BSA, 100 pmole of each primer, 0–100 pg of E. coli B DNA, 5.5 mM MgSO₄, and 1 U of Thermococcus kodakaraensis (KOD) hot start DNA polymerase (Novagen, Toyobo, Japan) in 1× manufacturer's buffer. PCR products (12 µL) were electrophoresed in 2% agarose gel with Tris–Acetate–EDTA buffer containing 0.75 µg/mL ethidium bromide.

^bElongation occurs within a temperature range surrounding 72°C, therefore, a large fraction of the ramp time during the heating stroke is utilized for elongation. If a fast enzyme such as KOD polymerase is used, it is possible to copy up to 1000 bp during the heating stroke, without pausing at 72°C.