Wilms’ tumor protein and FLT3‐internal tandem duplication expression in patients with de novo acute myeloid leukemia

Abstract

Bone marrow samples of 30 patients with de novo adult acute myeloid leukemia (AML) were analyzed for Wt1 and FLT3‐internal tandem duplication (FLT3‐ITD) expression measured by western blot and reverse transcription‐polymerase chain reaction analysis, respectively. Wt1 was detected in 53·3% of AML patients (16/30), while FLT3‐ITD in 23·3% (7/30). The high Wt1 expression correlated with the presence of FLT3‐ITD (P = 0·014) and lower rate of complete remission (P = 0·023). The cumulative survival in AML patients was affected significantly by the presence of FLT3‐ITD, being lower in the FLT3‐ITD (+) group (6·0±2·4 months) compared to the FLT3‐ITD (−) patients (17·9±3·3; P = 0·04). The expression of FLT3‐ITD could probably activate Wt1 expression in AML blast cells and thus might contribute to its oncogenic function to provide cells with survival advantages in vivo. The detection of both molecular markers (Wt1 and/or FLT3‐ITD) may be helpful in defining high risk AML patients that need special therapeutic strategies.

Keywords:

• Acute myeloid leukemia
• Wilms’ tumor protein
• FLT3‐ITD

Introduction

The product of Wilms’ tumor 1 (WT1) gene is a 52‐ to 54‐kDa nuclear protein that is an important regulatory molecule involved in cell growth and development. Although Wt1 protein can induce G1 arrest and apoptosis in myeloblastic leukemia cells,1 it has also an anti‐apoptotic role. This is suggested by the fact that cells of the metanephric blastema, which are required for normal kidney development, fail to proliferate and undergo apoptosis in WT1^−/− knockout.2 Consistent with this hypothesis, Wt1 was found to inhibit p53‐mediated apoptosis and to induce the expression of antiapoptotic genes such as BCL‐2.3,4 It has been proposed that the anti‐apoptotic function of Wt1 may potentiate tumorigenesis by a failure of apoptotic mechanisms. Supporting this idea, Wt1 has been found to be expressed in several malignant tissues.5,6 Particularly, in acute myeloid leukemias (AML), WT1 transcripts might be detected in the bone marrow cells of 70–80% patients at diagnosis.7^–9 Besides, high WT1 expression seems to be associated with unfavorable clinical outcome due to lower complete remission (CR) rates, and reduced disease‐free survival and overall survival (OS).10,11 High WT1 expression in AML patients have been demonstrated to be associated with FMS‐like tyrosine kinase 3 (FLT3) mutations.12 FLT3, a member of the family class 3 receptor tyrosine kinases, is preferentially expressed in hematopoietic progenitor cells and mediates stem cell differentiation and proliferation.13 The gene encoding FLT3 maps to chromosome band 13q12 and comprises 24 exons that span a genomic region of approximately 100 kb.14,15 FLT3 mutations are associated with proliferation of leukemic cells and inhibition of apoptosis16,17 and have been detected in about 30% of AML patients. The most frequent FLT 3 mutations are FLT3‐ITD (FLT3 – internal tandem duplication) – 23%. It has been suggested that patients bearing FLT3 ITD have significantly worse clinical outcomes.18,19

Since there is limited data concerning the expression level of Wt1 and FLT3 ITD in untreated de novo adult AML patients, we decided to evaluate the intracellular quantity of these molecular markers and to correlate their expression pattern at diagnosis with clinical outcome.

Patients, Materials and Methods

Patients

A total of 30 adult non‐promyelocytic patients below 60 years of age, diagnosed with de novo AML in our center between January 2005 and July 2008 were analyzed. AML was diagnosed according to criteria of the World Health Organization (WHO) classification.20 The main characteristics of the patients are summarized in Table 1. Informed consent according to the criteria of the local ethical commission was obtained.

Table 1. Patients characteristics

Patients
n	30
Age (n = 30) (years)
Median	48
Range	27–59
AML patients <60 years	30
Gender – no. of patients (%)
Male	20	(66·7)
Female	10	(33·3)
De novo AML	30
WBC count (×10^9/l)
Median	19·5
Range	1·7–337
Hemoglobin level (g/l)
Median	95
Range	50–140
PLT count (×10^9/l)
Median	60
Range	5–264
WHO subtype – no. of patients (%)
AML with recurrent cytogenetic translocations	9	(30)
AML with multilineage dysplasia – without prior MDS	2	(6·7)
AML not otherwise categorized	19	(63·3)
Cytogenetic risk group – no. of patients
Low [t(8;21/AML1‐ETO n = 5; inv(16)/CBFB‐MYH11 n = 4)]	9
Intermediate risk (normal karyotype n = 13)	13
High risk (complex karyotype n = 2)	2
No metaphases available*	6

Note: *RT‐PCR for AML1‐ETO, CBFb‐MYH11, PML‐RARa, and BCR‐ABL was performed and tested negative in all patients.

The median age of the patients was 48 years (range, 27–59 years). Twenty patients were males and 10 females. Five patients were positive for AML1‐ETO and four for CBFB‐MYH11. Thirteen patients had normal karyotypes. Two patients had high cytogenetic risk and in six patients, no metaphases were available.

Treatment

All patients were treated according to standard chemotherapy protocols, which included two induction courses with combinations of cytosine‐arabinoside (AraC, 100 mg/m²; days 1–7); anthracycline (Idarubicin, 12 mg/m²) or epirubicin (50 mg/m²) (days 1–3); with or without etoposide (100 mg/m²; days 1–5).

Criteria for response

The induction response was assessed 10–14 days after the induction chemotherapy course. CR, partial response (PR) and resistance were defined according to the bone marrow percentage of <5, 5–25, and >25% of residual blast cells after induction therapy. Causes of therapeutic failure were subdivided into two categories: (i) refractory disease; and (ii) death less than 7 days after completion of the first induction therapy (early death) or death during induction therapy – induced bone marrow hypoplasia (hypoplastic death).21

Isolation of mononuclear cells and nucleic acids

Heparin or EDTA stabilized bone marrow aspirates (30 AML patients and 4 individuals with non‐hematological diseases) or peripheral blood samples (10 healthy controls) were taken and subjected to isolation of mononuclear cells. After density gradient sedimentation using Ficoll‐Paque PLUS (Amersham Bioscience Ltd, Uppsala, Sweden) the samples were washed twice in phosphate‐buffered saline (PBS), counted using a hemocytometer and stored at −85°C.

Total RNA was isolated from mononuclear cells according to Chomczynski et al.22 using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s protocol.

Western blot

For obtaining whole cell lysates, pellets containing 2×10⁶ cells, were resuspended in buffer [0·1 M NaCl, 25 mM Tris‐HCl (pH = 8·0), 0·001 M EDTA (pH = 8·0), 25% (v/v) glycerol, 10% (v/v) beta‐mercaptoethanol, 1 mM phenylmethylsulphonyl fluoride, 50 μg/ml aprotinin, 1 mM Na₃VO₄, and 2 mg/ml leupeptin]. After vigorously vortexing, SDS loading buffer was added and vortexed again. Lysates were boiled for 5 minutes at 100°C and centrifuged at 13 000 revolutions/minute (13 600g) for 10 minutes at room temperature. Whole cell lysates corresponding to 300 000 cells were loaded on 12% SDS–polyacrylamide gel, separated by electrophoresis and transferred to a polyvinylidene difluoride membrane, blocked with 5% (w/v) skimmed milk in PBS and incubated for 2 hours with the primary antibodies WT1 (F‐6) mouse monoclonal: sc‐7385, diluted (1∶400) in ×1 PBS, 0·5% (w/v) skimmed milk and 0·5% (v/v) Triton X‐100. After washing four times in 1% (w/v) skimmed milk and 1% (v/v) Triton X‐100 in ×1 PBS, secondary horseradish peroxidase (HRP)‐conjugated antibodies (goat anti‐mouse IgG‐HRP: sc‐2005 and goat anti‐rabbit IgG‐HRP: sc‐2004) were added (1∶2000) and incubated for additional 45 minutes. Blots were visualized using chemiluminescence recorded on an X‐ray film. All antibodies and chemiluminescent reagent were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA).

Western blot products were classified as negative (−); weakly positive (+), and strongly positive (++/+++) as indicated in Fig. 1.

Figure 1. Western blot detection of Wt1 expression (52 kDa). p: positive control (cell line K‐562); n: negative control (cell line U‐937); lane 1–6: samples from AML patients. Semiquantitative probe evaluation: samples 1, 2, and 4 are negative (−), samples 5 and 6 are weekly positive (+) and sample 3 is strongly positive (+++).

Reverse transcription‐polymerase chain reaction (RT‐PCR)

Complementary DNA was synthesized using 1 μg RNA in 20 μl medium containing 5 mM random hexamers (Roche Applied Science, Mannheim, Germany), ×1 first strand buffer, 5 mM MgCl₂, 10 mM each of deoxynucleotides (Promega, Madison, WI, USA), 20 U RNasin and 200 U moloney murine leukemia virus reverse transcriptase (Promega) by consecutive incubation of the samples at 37°C for 1 hour and at 98°C for 3 minutes.23

PCR analysis of FLT3‐ITD

Five microliters of complementary DNA were amplified in 25 μl reaction medium, containing 200 μM each of deoxynucleotides (Promega); ×1 PCR buffer, 1·5 mM MgCl₂; 0·8 U Taq polymerase (ABgene, Epsom, UK) and 0·4 pM each of primers 5′‐TGTCGAGCAGTACTCTAAACA‐3′ and 5′‐ATCCTAGTACCTTCCCAAACTC‐3′ PCR.24 The reaction was done by Mastercycler Gradient (Eppendorf, Hamburg, Germany) and was started with a denaturation at 94°C for 5 minutes; proceeded with 37 cycles of denaturation at 94°C for 60 seconds; 59°C for 60 seconds; 72°C for 60 seconds; and terminated at 72°C for 10 minutes. PCR products were resolved on a 2·5% super fine resolution agarose gel (Amresco, Solon, OH, USA) stained with ethidium bromide (Fig. 2).

Figure 2. RT‐PCR detection of FLT3‐ITD.

Statistics

All statistical analysis was performed using the SPSS for Windows 8·0·15 software. OS was calculated from diagnosis till death. The survival curves were estimated by the Kaplan–Meier method. The log rank test was used to assess the significance of difference in survival. Comparisons were performed using Fisher’s exact test for binary variables and Mann–Whitney test for continuous variables. A value of P was considered significant when less than 0·05.

Results

Wt1 expression in healthy individuals and non‐hematologically ill patients

All 10 peripheral blood samples taken from healthy blood donors were negative for Wt1 protein expression. Three bone marrow samples taken from non‐hematologically ill patients were Wt1 negative and the fourth sample expressed Wt1 at a very low level (data not shown).

Wt1 and FLT3‐ITD expression in AML patients at diagnosis

Wt1 protein expression was detected in 16 AML patients (53·3%) and high levels were observed in nine patients (30%). Expression levels of Wt1 were not associated with absolute leukocyte count, hemoglobin level, platelet count, blast counts, sex or age. Moreover, no significant correlation of the Wt1 expression with cytogenetic characteristics of leukemias could be established (Table 2).

Table 2. Correlation of Wt1 with common cytogenetic aberrations in AML patients

	Total	No Wt1		Low Wt1		High Wt1
		n (%)		n (%)		n (%)
AML total	30	14	(46·7%)	7	(23·3%)	9	(30%)
Cytogenetics (n = 24)	24
Normal karyotype		5	(38·5%)	3	(23%)	5	(38·5%)
t(8;21)/AML1‐ETO and inv(16)/CBFB‐MYH11		6	(66·7%)	3	(33·3%)	…
Other karyotypes				1	(50%)	1	(50%)

FLT3‐ITD was recorded in seven patients with AML (23·3%). No significant correlation of FLT3‐ITD expression with cytogenetic aberrations was found (Table 3).

Table 3. Correlation of FLT3‐ITD with common cytogenetic aberrations in AML patients

	Total	No FLT3‐ITD		FLT3‐ITD
		n (%)		n (%)
AML total	30	23	(76·7%)	7	(23·3%)
Cytogenetics (n = 24)	24
Normal karyotype		8	(61·5%)	5	(38·5%)
t(8;21)/AML1‐ETO and inv(16)/CBFB‐MYH11		9	(100%)	…	…
Other karyotypes		2	(100%)	…	…

Correlation of the Wt1 and FLT3‐ITD expression in AML patients at diagnosis

We found that 16 patients were Wt1 positive and seven patients FLT3‐ITD positive. In the cohort of cases with undetectable FLT3‐ITD, 19 of 23 (82·6%) AML patients had undetectable and low levels of Wt1. Five patients positive for FLT3‐ITD showed high Wt1 expression (71·4%) (Fig. 3).

Figure 3. Co‐expression of Wt1 protein and FLT3‐ITD in de novo AML patients.

Thus statistical data analysis indicates, that FLT3‐ITD expression significantly correlates with high Wt1 expression (P = 0·014).

Influence of the expression of Wt1 and FLT3‐ITD expression on therapy response and long‐term outcome

In accordance to Galimberti et al.,25 patients with Wt1 protein expression were stratified in two subgroups: one with no or low and the other with high Wt1 protein expression. Among AML patients with low or undetectable Wt1 protein levels at diagnosis (‘Wt1 negative’), therapeutic response [CR (n = 9)+PR (n = 2)] was observed in 11/21 (52·4%) patients, 7/21 (33·3%) had resistant disease and 3/21 (14·3%) died during the induction therapy. Patients with high Wt1 expression (‘Wt1 positive’), therapeutic response [PR (n = 2)] was seen in 2/9 (22·2%) patients, 6/9 (66·7%) had resistant disease and 1/9 (11·1%) died during the induction. Thus, statistically significant relationship was established between the Wt1 level of expression and the achievement of CR rate (P = 0·023).

No significant correlation of Wt1 expression with overall survival was established.

Therapeutic response [PR (n = 2)] was recorded in 2/7 (28·6%) of AML patients bearing FLT3‐ITD mutation, 4/7 (57·1%) had a resistant disease and one patient (14·3%) died during the induction therapy. Patients with no FLT3‐ITD expression achieved a therapeutic response [CR (n = 9)+PR (n = 2)] in 11/23 (47·8%), refractory disease was found in 9/23 (39·1%) and induction death was observed in 3/23 (13%) of the cases. No significant relationship could be established between the FLT3‐ITD expression and therapeutic response or rate of CR.

However, the cumulative OS of AML patients was significantly affected by the presence of FLT3‐ITD being significantly lower in FLT3‐ITD positive group (6·0±2·4 months) as compared to FLT3‐ITD negative group (17·9±3·3 months; P = 0·04) (Fig. 4).

Figure 4. Overall survival of all de novo diagnosed AML patients according Kaplan‐Meier calculation in relation to FLT3‐ITD expression [no FLT3‐ITD (−) versus FLT3‐ITD (+)].

Discussion

Induction of apoptosis is the main mechanism by which many chemotherapeutic agents, used in the treatment of AML, exert their cytotoxic effect.26,27 Poor response to induction therapy or persistence of residual disease may be caused by resistance of leukemic blasts to induction of apoptosis. Consequently, the regulation of apoptotic or antiapoptotic pathways is of high clinical importance regarding remission induction or overcoming of drug resistance. A number of molecules are known to control cellular apoptosis machinery such as Wt1, FLT3, bcl‐2 family of proteins, etc.

In our study, we investigated the value of Wt1 and FLT3‐ITD expression, measured by western blot analysis and RT‐PCR, respectively, as potential determinants of therapeutic response and prognosis. Wt1 protein expression was detected in 53·3% of patients, whereas high levels were observed in 30% of the cohort. To our knowledge, this is the first study of Wt1 protein expression in AML patients, using western blot analysis. Similarly, using another methodological approach by immunofluorescent staining with mono‐ and polyclonal anti‐Wt1 antibodies, Menssen et al.28,29 obtained comparable incidence of Wt1 protein expression in the blast cell nuclei of 50–63% of acute leukemia patients without any detectable reaction in the nuclei of normal CD34⁺ hematopoietic progenitor cells, while Al‐Adnani et al.,30 observed 40% positivity by immunohistochemistry in childhood AML. Even though data obtained by immunological approaches for the detection at protein level are very scarce as a rule they show lower incidence of the marker in acute leukemias as compared to molecular RT‐PCR‐based studies which have reported overexpression of WT1 mRNA in up to 90% of patients with AML.31 The differences reported by immunological and molecular approaches can be explained by differences in the sensitivity, criteria employed to judge Wt1 protein/WT1 gene positivity or post‐translational modifications. Besides, these differences might underlie different interpretation of clinical associations and prognostic estimation.

Since the gene plays its biological role by the encoded protein, it could be suggested that data provided by protein expression assays might better discriminate leukemias with different biological behavior. Therefore, we correlated our findings concerning Wt1 protein expression with major clinical and laboratory characteristics of the patients included in the study. In line with previously reported data,12 we also failed to establish any significant differences in the clinical, hematological or cytogenetic characteristics of the patients and overall survival rates, according to the presence or the absence of the Wt1 protein. However, in our study, high Wt1 protein expression levels have been clearly related to significantly lower rates of CR in AML patients (P = 0·023). This is in contrast to other studies, which did not discriminate the differences in the expression levels and failed to establish any correlation between WT1 gene expression and the therapeutic response or survival rates.32

Insights into the regulation of Wt1 expression are essential for understanding the role that Wt1 plays during normal and abnormal development. Various factors have been shown to modulate the expression of the WT1 including FLT3 mutations.12 FLT3 mutations are associated with proliferation of leukemic cells and inhibition of apoptosis, the most frequent of them are FLT3‐ITD.

In our study, FLT3‐ITD mutations have been detected in 23·3% of AML patients. Although no significant relationship could be established between the FLT3‐ITD expression and therapeutic response or rate of CR, the absence of this molecular marker is associated with longer overall survival (P = 0·04). This is in line with several previously published studies.33^–35

As expected, a significant correlation between FLT3‐ITD and high Wt1 expression was observed (P = 0·014). Since FLT3‐ITD and Wt1 are apoptosis downregulating molecular markers, we can speculate that their combination could result in augmented proliferation and differentiation failure as well as inhibition of programmed cell death and this might explain the lack of CR in patients with simultaneous expression of FLT3‐ITD and Wt1.

In two (28·6%) cases, however, we did not find any Wt1 expression despite presence of FLT3‐ITD, who presented also with unfavorable therapeutic response. The absence of Wt1‐expression in the presence of FLT3‐ITD might be explained partially by possible silencing of the Wt1 expression by WT1 gene mutations. King‐Underwood and Pritchard‐Jones36 reported that WT1 gene mutations occur in 14% of AML patients and that the presence of a WT1 mutation is associated with failure to achieve CR and lower survival rates.

In conclusion, to our knowledge, this is the first reported study of Wt1‐protein expression in association with FLT3‐ITD, measured by western blotting and RT‐PCR analysis, respectively, in patients with de novo AML. The presence of FLT3‐ITD and/or high Wt1‐expression level at diagnosis is a poor prognostic indicator. The detection of both molecular markers (Wt1 and/or FLT3‐ITD) may be helpful in defining high‐risk AML patient groups that need special modified therapeutic strategies.

The study was supported by the National Science Fund, Bulgarian Ministry of Education and Science (Grant VU‐L‐203/06).