Abstract
Purpose
Radiotherapy is a major treatment method for patients with non-small cell lung cancer (NSCLC). However, the presence of radioresistant cancer stem cells (CSCs) may be associated with disease relapse or a poor outcome after radiotherapy. Voltage-gated calcium channel α2δ1 subunit (encoded by the gene CACNA2D1) isoform 5 is a marker of CSCs in hepatocellular carcinoma. This study aimed to investigate the radiosensitivity of α2δ1-high cells in NSCLC cell lines.
Materials and methods
NSCLC cell lines A549, H1975, H1299, and PC9 were used. CACNA2D1-knockdown and CACNA2D1-overexpressing cell lines were established by lentiviral infection. Colony formation assay was performed to determine radiosensitivity. Sphere formation assay in serum-free medium was performed to evaluate self-renewal capacity. Proteins associated with DNA damage repair were analyzed by immunofluorescence or Western blot. The monoclonal antibody of α2δ1 was applied alone or in combination with radiation either in vitro or in vivo to determine the anti-tumor effect of the antibody.
Results
α2δ1-high cells showed greater sphere-forming efficiency than α2δ1-low cells and were relatively resistant to radiation. CACNA2D1 knockdown in A549 cells enhanced radiosensitivity, whereas CACNA2D1 overexpression in PC9 and H1975 cells reduced radiosensitivity, suggesting that α2δ1 imparted radioresistance to NSCLC cells. Analysis of proteins involved in DNA damage repair suggested that α2δ1 enhanced the efficiency of DNA damage repair. The monoclonal antibody of α2δ1 had a synergistic effect with that of radiation to block the self-renewal of α2δ1-high cells and enhanced the radiosensitivity of α2δ1-positive cells in colony formation assays. The combination of the α2δ1 antibody with radiation repressed A549 xenograft growth in vivo.
Conclusion
α2δ1 enhances radioresistance in cancer stem-like cells in NSCLC. The α2δ1 monoclonal antibody sensitizes α2δ1-high cells to radiation, suggesting that the antibody may be used to improve the treatment outcome when combined with radiation in NSCLC.
Introduction
Radiotherapy is a major treatment method for patients with non-small cell lung cancer (NSCLC). However, a certain proportion of tumors do not respond effectively to radiation or relapse after radiotherapy, which may be due to the existence of radioresistant cancer stem cells (CSCs).Citation1,Citation2 CSCs are typified by their self-renewal capacity and ability to generate heterogenous cancer cells that constitute the bulk of the tumor.Citation3,Citation4 Radioresistance of CSCs has been reported in several types of malignant tumors. In glioma, CD133-positive CSCs activate the DNA damage checkpoint more effectively, leading to more rapid DNA damage repair.Citation5 Inhibitor of CHK1 and CHK2 checkpoint kinases can abrogate the radioresistance of CD133-positive cells.Citation5,Citation6 A study on breast cancer has shown that CD24-negative/low CD49f-positive Lin-negative CSCs exhibit higher levels of free-radical scavenging systems, resulting in lower levels of reactive oxygen species (ROS) and resistance to radiation. Moreover, ROS scavenger inhibitors radiosensitize breast CSCs.Citation7 In lung cancer cell lines, the upregulation of CSC markers, such as CD44, CD24, and aldehyde dehydrogenase (ALDH)1 after radiation has been reported, suggesting the radioresistance of CSCs in lung cancer.Citation8,Citation9 Therefore, drugs specifically targeting CSCs could be promising approaches to avoid radioresistance without increasing normal tissue damage.
A specific surface antibody targeting CSCs, namely 1B50-1, was identified using subtractive immunization by a pair of hepatocellular carcinoma (HCC) cell lines, Hep-11 and Hep-12. These two cell lines were established from primary and recurrent HCC tissue respectively, from the same patient. 1B50-1 specifically targeted the Hep-12 cells, which showed tumor-initiating capacity. By immunoprecipitation and mass spectrometry analysis, the antigen of 1B50-1 was identified as calcium channel α2δ1 subunit (encoded by the gene CACNA2D1) isoform 5.Citation10 α2δ1-positive HCC cells express higher levels of stem cell-associated genes and show high tumorigenicity. When combined with a chemotherapy regimen, 1B50-1 exhibits a therapeutic effect on HCC engraftment by eliminating CSCs. Notably, α2δ1 isoform 5 is specifically expressed in HCC stem cells and is undetectable in most normal tissues. This expression pattern highlights α2δ1 isoform 5 as a promising candidate for targeting CSC.Citation10
In this study, we observed that the radioresistance of several NSCLC cell lines was correlated with their α2δ1 expression levels. Therefore, we investigated the radiosensitivity of α2δ1-high cells among the NSCLC cell lines and evaluated the effect of the α2δ1 monoclonal antibody on the radiosensitivity of α2δ1-high NSCLC cells.
Materials and methods
Cell culture
A549, H1299, and H1975 were purchased from American Type Culture Collection, and PC9 was a gift from Dr Yuanyuan Ma in th Department of Thoracic Surgery II, Peking University Cancer Hospital and Institute. The identity of PC9 was confirmed by Short Tandem Repeat profiling. The research was approved by the ethics committee of Peking University Cancer Hospital and Institute. Cells were cultured in RPMI-1640 (Invitrogen, Waltham, MA, USA) supplemented with 10% FBS (Invitrogen). To establish CACNA2D1-overexpressing or CACNA2D1-knockdown cell lines, lentivirus was generated according to the protocol of Zhao et alCitation10 Cells were transfected with lentivirus and selected for blasticidin resistance according to the protocol of Lan et alCitation11
Colony formation assay
Colony formation assay was performed to determine the radiosensitivity of the cells. Cells were seeded at densities of 100–1,000 cells per well in 12-well plates 1 day before irradiation. Culture medium was added to a height of 1 cm to ensure dose build-up. Cell irradiation was performed with a 600-C/D linear accelerator (Varian Medical Systems, Inc., Palo Alto, CA, USA) with 6-MV X-ray. Culture medium was replaced after irradiation. After 7–10 days, the cells were fixed with 4% formaldehyde and stained with crystal violet. Colonies with >50 cells were counted. The colony formation efficiency was calculated as the number of colonies divided by the number of cells seeded. The survival fraction was calculated as the colony formation efficiency at a certain irradiation dose divided by the colony formation efficiency at 0 Gy.
Sphere formation assay
Sphere formation assay was performed to determine the self-renewal capacity of the cells. The cells were seeded at a density of 200 cells per well in 96-well ultralow-attachment plates (Corning, Tewksbury, MA, USA) in DMEM/F12 containing 1% methylcellulose (Sigma-Aldrich, St. Louis, MO, USA), 25 ng/mL EGF, 25 ng/mL basic fibroblast growth factor, and 2% B27. After 10-–14 days of seeding, the number of spheres was counted under a microscope. Reagents were purchased from Invitrogen if not otherwise indicated.
Flow cytometry
1B50-1 was conjugated with fluorescein with the Lightning-Link Fluorescein kit (Innova Biosciences Ltd., Cambridge, UK). The stocking concentration of the fluorescein isothiocyanate-conjugated α2δ1 antibody was 1.5 mg/mL. The antibody was titrated and the optimal working concentration was 7.5 µg/mL. Cells were digested with trypsin, labeled with 1B50-1-fluorescein at room temperature for 40 minutes, and washed three times with PBS. Flow cytometric analysis was performed on an Accuri C6 flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA). The median fluorescence intensity (MFI) was calculated by FlowJo. Cell sorting was performed on a FACSAria flow cytometer (BD Biosciences).
Western blot
SDS-PAGE was performed, and protein was transferred to a polyvinylidene fluoride membrane (Millipore, Billerica, MA, USA). The membrane was blocked with 5% milk (BD Biosciences) in tris-buffered saline-Tween 20 (TBST) for 1 hour and incubated with primary antibody for 3 hours at room temperature. Then the membrane was washed with TBST three times and incubated with secondary antibody for 1 hour at room temperature. The Immobilon western chemiluminescent substrate (Millipore) was applied to the membrane, and signals were captured with the MiniChemi luminescent imaging and analysis system (Sage Creation Science Co, Ltd., Beijing, China).
The primary antibodies used were as follows: mouse anti-α2δ1 (Abcam, Cambridge, UK, 1:2,500), rabbit anti-γH2AX (Cell Signaling Technologies, Danvers, MA, USA, 1:1,000), rabbit anti-ataxia telangiectasia mutated (ATM) (Cell Signaling Technologies, 1:1,000), rabbit anti-phospho-ATM (Ser1981) (Cell Signaling Technologies, 1:1,000), rabbit anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH; Biodragon, Beijing, China, 1:10,000), and rabbit anti-β-actin (Biodragon, 1:10,000). The secondary antibodies used were as follows: goat anti-mouse horseradish peroxidase (HRP)-conjugated antibody (Zhongshan, Beijing, China, 1: 100,000) and goat anti-rabbit HRP-conjugated antibody (Zhongshan, 1:100,000). All antibodies were diluted in TBST containing 5% milk.
Immunofluorescence
Cells were fixed with 4% formaldehyde for 5 minutes at room temperature and permeabilized with 0.5% Triton-X100 in PBS for 30 minutes. Cells were blocked in PBS with 5% goat serum (Zhongshan) for 1 hour and incubated with γH2AX antibody (Cell Signaling Technologies, 1:400) in PBS containing 5% goat serum at 4°C overnight. Cells were then washed with PBS three times, incubated with goat anti-rabbit rhodamine-conjugated secondary antibody (Zhongshan, 1:200) at room temperature for 1 hour, and washed with PBS three times. Nuclei were stained with DAPI. Cells were examined under a Leica SP5 confocal microscope (Leica, Wetzlar, Germany).
Quantitative PCR (qPCR)
RNA was extracted with TRIzol (Invitrogen) and reverse transcribed with Moloney murine leukemia virus reverse transcriptase (Invitrogen). qPCR was performed with the SybrGreen dye (Toyoba, Osaka, Japan) on an ABI 7500-Fast real-time PCR system (Applied Biosystems, Waltham, MA, USA). Relative expression was calculated as 2−ΔΔCt.
The primer sequences were as follows: CACNA2D1-F, CAGTTGAGATGGAGGATGATG; CACNA2D1-R, TTG-TATGAGCAGTCGTGTGTC; NANOG-F, TGCCTCACACG-GAGACTGTC; NANOG-R, TGCTATTCTTCGGCCAGTTG; OCT4-F, GACAACAATGAAAATCTTCAGGAGA; OCT4-R, CTGGCGCCGGTTACAGAACCA; RAD51-F, CAGTGATGTCCTGGATAATGTAGC; RAD51-R, TTACCACTGCTACACCAAACTCAT; BRCA1-F, AGCAGAATGGTCAACTGATGAATA; BRCA1-R, ACTGCTGCTTATAGGTTCAGCTTT; CHEK2-F, TGATCAGTCAGTTTATCCTAAGGC; CHEK2-R, TCGAAAGCCAGCTTTACCTC; MDC1-F, CAGTCCAGAG-CATGGAGGAT; MDC1-R, AATGGCTGTGTAGCCAGGAC; GAPDH-F, GTCGGAGTCAACGGATTTGG; and GAPDH-R, AAAAGCAGCCCTGGTGACC.
Mouse xenograft model
Six-week-old female BALB/c nude mice were purchased from Vital River Laboratory Animal Technology Co. (Beijing, China). A total of 2×106 A549 cells were injected subcutaneously into the right leg of each mouse. When the tumor volume reached 200–250 mm3, mice were randomly assigned to four groups (n=5): control, antibody, radiation, and radiation plus antibody. For radiation, the mice were anesthetized by intraperitoneal injection of pentobarbital sodium. The right leg bearing the tumor was positioned in the radiation field. A tissue equivalent bolus of 1.0 cm thickness was placed on top of the tumor to provide dose build-up. A single dose of 10 Gy X-ray or sham irradiation was delivered by a 600-C/D linear accelerator (Varian Medical Systems, Inc., Palo Alto, CA, USA). A total of 800 µg of 1B50-1 or its isotype IgG3 was administered every other day by intraperitoneal injection. The tumor size was measured with a digital caliper, and the tumor volume was calculated with the following formula: V(mm3)=larger diameter×(smaller diameter)Citation2×0.5. All animal experiments were performed in accordance with protocols approved by the ethics committee of Peking University Cancer Hospital and Institute.
Statistics
GraphPad Prism was used to analyze the data. The unpaired two-sided Student’s t-test was performed to evaluate the significance between groups. P<0.05 was considered to be statistically significant. Data are represented as the mean and SD if not otherwise indicated. Representative data from at least three biologically independent experiments with similar results are presented.
Results
α2δ1-positive NSCLC cells are relatively radioresistant
The radiosensitivity of several NSCLC cell lines was evaluated by colony formation assay. H1299 and A549 were relatively resistant to radiation, whereas H1975 was sensitive to radiation (). To determine the correlation between radiosensitivity and candidate CSC marker α2δ1, we analyzed the α2δ1-positive proportion by flow cytometry. The results showed that H1299 and A549 expressed relatively high level of α2δ1, PC9 expressed low level of α2δ1, and H1975 was negative for α2δ1 (). This pattern led to the hypothesis that α2δ1 expression was related to NSCLC cell radioresistance. Therefore, α2δ1-high and α2δ1-low A549 and H1299 cells were sorted. Colony formation analysis showed that compared with the α2δ1-low cells, the α2δ1-high cells were relatively resistant to ionizing radiation ().
α2δ1 marks CSCs in HCC.Citation10 To investigate the feasibility of α2δ1 as a CSC marker in NSCLC, we sorted the α2δ1-high and α2δ1-low cells and evaluated the self-renewal capacity by sphere formation analysis. The α2δ1-high cells had a higher sphere-forming capacity than their α2δ1-low counterparts, and the sphere formation efficiency of α2δ1-high cells increased in subsequent serial propagation (). We used lentivirus to overexpress CACNA2D1 in the α2δ1-negative H1975 and α2δ1-low PC9 cell lines. CACNA2D1 overexpression increased the sphere formation efficiency (). Conversely, CACNA2D1 knockdown in A549 cells resulted in a reduction in the sphere formation efficiency (). These results indicated that the α2δ1-positive cells had high self-renewal capacity, which was a major characteristic of CSCs.
Studies on radioresistant CSCs have shown that the percentage of CSCs increases after radiation.Citation5,Citation7,Citation12 We found that the α2δ1-positive proportion was enhanced after radiation in a dose-dependent manner (). These data demonstrated that the α2δ1-high NSCLC stem-like cells were relatively radioresistant.
α2δ1 imparts radioresistance to NSCLC cells
To determine whether α2δ1 was just a surface marker for radioresistant NSCLC stem cells or it played a role in the acquisition of radioresistance, we performed a colony formation analysis of CACNA2D1-overexpressing H1975 and PC9 cells and CACNA2D1-knockdown A549 cells. The survival curves showed that radioresistance was acquired in CACNA2D1-overexpressing H1975 and PC9 cells (). In contrast, CACNA2D1 knockdown by shRNA sensitized A549 cell line to radiation (). The changes in radiosensitivity induced by the overexpression or knockdown of CACNA2D1 suggested that α2δ1 imparted radioresistance to the NSCLC cells.
Radiosensitivity is associated with the capacity of DNA damage repair. We examined the kinetics of γH2AX, which marks the DNA double-strand break sites. Immunofluorescence staining showed that the number of γH2AX foci increased after radiation and that the number of foci decreased more rapidly in the CACNA2D1-overexpressing cells than in the control group, indicating a more efficient capacity of DNA damage repair in the CACNA2D1-overexpressing H1975 cells (). The Western blot results also showed faster downregulation of γH2AX in the CACNA2D1-overexpressing group than in the control one (). We also examined the level of phosphorylated ATM, which initiates the DNA damage repair machinery.Citation13 In the sorted A549 cells, the α2δ1-high cells showed higher levels of activated ATM upon radiation, which represented a more efficient capacity of DNA damage repair (). These data collectively suggested that α2δ1 imparted the radioresistance to NSCLC cells partially by enhancing the efficiency DNA damage repair in response to radiation.
The expression levels of other DNA damage repair-related genes and stem cell markers were analyzed by qPCR. Among these genes, NANOG, a transcription factor that regulates embryonic stem cell pluripotency and is associated with CSCs and a worse clinical outcome,Citation14 and RAD51, the recombinase catalyzing the process of homologous recombination after DNA double-strand breaks,Citation15 were upregulated in the CACNA2D1-overexpressing H1975 cells and downregulated in the CACNA2D1-knockdown A549 cells. DNA damage repair-related genes BRCA1, CHEK2, and MDC1 were also upregulated in CACNA2D1-overexpressing H1975 in a mild manner, but not all these genes were downregulated in CACNA2D1-knockdown A549. The expression of OCT4 was not affected by α2δ1 overexpression or knockdown (). We also performed Gene Expression Omnibus (GEO) profile analysis of CACNA2D1 and DNA damage repair-related genes. In a data set of histologically normal large-airway epithelial cells from smokers with suspected lung cancer (GSE4115),Citation16 the GEO profiles of the smokers who were ultimately diagnosed with lung cancer showed that the expression of CACNA2D1 was also positively correlated with the expression of NANOG, RAD51, BRCA1, and CHEK2 (). These results also implied the correlation between α2δ1 and the capacity of DNA damage repair.
1B50-1 blocks the self-renewal capacity of α2δ1-positive cells and enhances the radiosensitivity
1B50-1, the α2δ1 monoclonal antibody raised against a recurrent HCC cell line, blocks sphere formation in α2δ1- positive HCC cells and has a synergistic effect with that of chemotherapy.Citation10 We applied this antibody to the NSCLC cell lines and found that in the sorted α2δ1-high A549 cells, the 1B50-1 treatment blocked sphere formation (). Moreover, the combination of 1B50-1 and ionizing radiation reduced sphere formation to a much lower level (). In the colony formation assay, the 1B50-1 treatment enhanced the radiosensitivity of the α2δ1-high cells (). Conversely, 1B50-1 had a mild effect on the α2δ1-low cells (data not shown).
To explore the effect of 1B50-1 on NSCLC cells in vivo, subcutaneous A549 xenografts were established in nude mice. The mice were treated with 1B50-1 or radiation, or the combination of 1B50-1 and radiation. The 1B50-1 treatment alone had little effect on tumor size, whereas when combined with a single dose of 10 Gy radiation, tumor growth was blocked effectively. The combination modality also showed an advantage over radiation alone (). These results suggested that α2δ1 monoclonal antibody 1B50-1 specifically blocked the self-renewal capacity of the α2δ1-high cells and enhanced their radiosensitivity. The antibody had a synergistic effect with that of radiation on repressing the growth of the high α2δ1-expressing NSCLC cells in the mouse model.
Discussion
CSCs showed the capacity of self-renewal and tumor initiation and were resistant to cytotoxic therapies. Calcium channel α2δ1 subunit isoform 5 has been identified as a CSC marker in HCC.Citation10 In this study, we demonstrated that the α2δ1-high NSCLC cells also had self-renewal capacity and were resistant to radiation. The overexpression of CACNA2D1 imparted radioresistance to the NSCLC cells with a more efficient capacity of DNA damage repair after radiation. The α2δ1 monoclonal antibody blocked the self-renewal capacity of the α2δ1-high cells and sensitized them to radiation. Therefore, we propose α2δ1 as a target to eliminate radioresistant NSCLC stem cells.
The presence of CSCs in NSCLC has been reported, and CSCs have been selected based on CD133, CD166, CD44 positivity or ALDH activityCitation17–Citation20, or with serum-free self-renewal sphere culture medium.Citation21 We also examined the expression of CD166 in our experiments. CD166 expression was broad in A549, PC9, and H1975, and was about 50% in H1299, partially overlapping with that of α2δ1 (data not shown). The expression pattern of CD166 is not correlated with radioresistance, whereas the correlation with radioresistance is observed in α2δ1 expression. Therefore, we mainly focused on how α2δ1 regulates the radiosensitivity in NSCLC cell lines. In this study, the α2δ1-positive cells showed a higher sphere formation capacity in serum-free self-renewal medium than the α2δ1-negative cells, suggesting the feasibility of α2δ1 as a CSC marker. α2δ1 expression has also been reported to be associated with poor overall survival and progression-free survival in epithelial ovarian cancer.Citation22 Additionally, downregulation of CACNA2D1 by miR-107 promotes erythroid differentiation of chronic myeloid leukemia cells.Citation23 These studies also supported α2δ1 as a marker for CSCs.
CSCs are relatively resistant to conventional treatments, including radiotherapy. Our results showed that the α2δ1-high NSCLC cells were resistant to radiation compared with the α2δ1-low cells. CACNA2D1 overexpression in the α2δ1-negative or α2δ1-low cell lines resulted in radioresistance, whereas CACNA2D1 knockdown in the α2δ1-high cell line enhanced radiosensitivity. These data suggested that α2δ1 was more than just a surface marker of CSCs and radioresistance; it participated in the acquisition of intrinsic resistance to radiation. Ion channels play complicated roles in tumorigenesis and the sensitivity of tumors to treatment. Several ion channels have been reported to confer radioresistance via multiple mechanisms. Potassium channel activity is induced upon radiation in response to oxidative stress.Citation24 Palme et al have demonstrated that radiation activates the Kv3.4 voltage-gated potassium channel and enhances calcium entry, with subsequent activation of CaMKII and inactivation of cdc25B and cdc2. Kv3.4 channel inhibition with drugs or siRNA enhances radiosensitivity.Citation25 It has also been reported that radiation-stimulated Ca2+ entry and CaM-KII activiation participated in G2/M cell cycle arrest and survival of irradiated chronic myeloid leukemia cells.Citation26 α2δ1 is a voltage-gated calcium channel. Previous study on HCC has shown that α2δ1 regulates calcium influx and maintains calcium oscillation in the tumor-initiating cells of HCC and that the intracellular calcium concentration is elevated upon CACNA2D1 overexpression.Citation10 Moreover, phosphorylated ERK1/2 was upregulated by CACNA2D1 overexpression. This mechanism might be involved in the maintenance of CSC property and resistance to chemotherapy.Citation10,Citation27 In the NSCLC cell lines in this study, the increased phosphorylation level of ATM, rapid decrease in γH2AX after radiation and upregulation of DNA damage repair gene RAD51 in the CACNA2D1-overexpressing cell line or α2δ1-high cells suggests that α2δ1 might enhance radioresistance by imparting a more efficient capacity to repair DNA damage.
α2δ1 isoform 5 is the antigen of 1B50-1, which is the monoclonal antibody raised against recurrent HCC. 1B50-1 blocks the self-renewal of HCC stem cells.Citation10 In this study, our results showed that 1B50-1 had a synergistic effect with that of radiation toward suppressing sphere and colony formations among α2δ1-high NSCLC cells. Conversely, 1B50-1 had little effect on α2δ1-low cells, which were relatively more sensitive to radiation and had a much lower capacity of self-renewal, suggesting the specificity of 1B50-1 for targeting α2δ1-high cells. The targeting of CSCs has been proposed to repress tumor recurrence after radiation in preclinical mouse model. Li et al have reported that a CD44s antibody targets pancreatic tumor-initiating cells and represses the growth, metastasis, and recurrence of pancreatic cancer xenografts after radiotherapy.Citation28 In our study, 1B50-1 had a synergistic effect with that of radiation toward repressing xenograft growth in vivo. Considering the specificity of 1B50-1 on α2δ1-high NSCLC stem cells, 1B50-1 has the potential to eliminate CSCs when combined with radiotherapy in the treatment of NSCLC.
Conclusion
Our results suggest that α2δ1-high NSCLC cells are resistant to radiation and that α2δ1 imparts radioresistance partially by enhancing the efficiency for repair of DNA damage. Targeting α2δ1-high cells with the monoclonal antibody increases the radiosensitivity of α2δ1-high cells, suggesting the potential of the antibody to improve the treatment outcome when combined with radiation.
Acknowledgments
This work was supported by National Natural Science Foundation of China (81402535).
Disclosure
The authors report no conflicts of interest in this work.
References
- BrunnerTBKunz-SchughartLAGrosse-GehlingPBaumannMCancer stem cells as a predictive factor in radiotherapySemin Radiat Oncol201222215117422385922
- BaumannMKrauseMHillRExploring the role of cancer stem cells in radioresistanceNat Rev Cancer20088754555418511937
- ClarkeMFDickJEDirksPBCancer stem cells: perspectives on current status and future directions: AACR Workshop on cancer stem cellsCancer Res200666199339934416990346
- BoeschMZeimetAGReimerDThe side population of ovarian cancer cells defines a heterogeneous compartment exhibiting stem cell characteristicsOncotarget20145167027703925216521
- BaoSWuQMclendonREGlioma stem cells promote radioresistance by preferential activation of the DNA damage responseNature2006444712075676017051156
- WangWJWuSPLiuJBMYC regulation of CHK1 and CHK2 promotes radioresistance in a stem cell-like population of nasopharyngeal carcinoma cellsCancer Res20137331219123123269272
- DiehnMChoRWLoboNAAssociation of reactive oxygen species levels and radioresistance in cancer stem cellsNature2009458723978078319194462
- Gomez-CasalRBhattacharyaCGaneshNNon-small cell lung cancer cells survived ionizing radiation treatment display cancer stem cell and epithelial-mesenchymal transition phenotypesMol Cancer20131219423947765
- MihatschJToulanyMBareissPMSelection of radioresistant tumor cells and presence of ALDH1 activity in vitroRadiother Oncol201199330030621704411
- ZhaoWWangLHanH1B50-1, a mAb raised against recurrent tumor cells, targets liver tumor-initiating cells by binding to the calcium channel α2δ1 subunitCancer Cell201323454155623597567
- LanLHanHZuoHUpregulation of myosin Va by Snail is involved in cancer cell migration and metastasisInt J Cancer20101261536419521958
- CahuJBustanySSolaBSenescence-associated secretory phenotype favors the emergence of cancer stem-like cellsCell Death Dis20123e44623254289
- LavinMFKozlovSDNA damage-induced signalling in ataxia-telangiectasia and related syndromesRadiother Oncol200783323123717512070
- JeterCRYangTWangJChaoHPTangDGConcise Review: NANOG in cancer stem cells and tumor development: an update and outstanding questionsStem Cells20153382381239025821200
- GaspariniPLovatFFassanMProtective role of miR-155 in breast cancer through RAD51 targeting impairs homologous recombination after irradiationProc Natl Acad Sci U S A2014111124536454124616504
- SpiraABeaneJEShahVAirway epithelial gene expression in the diagnostic evaluation of smokers with suspect lung cancerNat Med200713336136617334370
- EramoALottiFSetteGIdentification and expansion of the tumorigenic lung cancer stem cell populationCell Death Differ200815350451418049477
- ZhangWCShyh-ChangNYangHGlycine decarboxylase activity drives non-small cell lung cancer tumor-initiating cells and tumorigenesisCell20121481–225927222225612
- LeungELFiscusRRTungJWNon-small cell lung cancer cells expressing CD44 are enriched for stem cell-like propertiesPLoS One2010511e1406221124918
- SullivanJPSpinolaMDodgeMAldehyde dehydrogenase activity selects for lung adenocarcinoma stem cells dependent on notch signalingCancer Res201070239937994821118965
- LundholmLHåågPZongDResistance to DNA-damaging treatment in non-small cell lung cancer tumor-initiating cells involves reduced DNA-PK/ATM activation and diminished cell cycle arrestCell Death Dis20134e47823370278
- YuDHolmRGoscinskiMATropeCGNeslandJMSuoZPrognostic and clinicopathological significance of Cacna2d1 expression in epithelial ovarian cancers: a retrospective studyAm J Cancer Res2016692088209727725913
- RuanJLiuXXiongXmiR-107 promotes the erythroid differentiation of leukemia cells via the downregulation of Cacna2d1Mol Med Rep20151121334133925373460
- KuoSSSaadAHKoongACHahnGMGiacciaAJPotassium-channel activation in response to low doses of gamma-irradiation involves reactive oxygen intermediates in nonexcitatory cellsProc Natl Acad Sci U S A19939039089128430104
- PalmeDMisovicMSchmidEKv3.4 potassium channel-mediated electrosignaling controls cell cycle and survival of irradiated leukemia cellsPflugers Arch201346581209122123443853
- HeiseNPalmeDMisovicMNon-selective cation channel-mediated Ca2+-entry and activation of Ca2+/calmodulin-dependent kinase II contribute to G2/M cell cycle arrest and survival of irradiated leukemia cellsCell Physiol Biochem2010264–559760821063097
- YuJWangSZhaoWMechanistic exploration of cancer stem cell marker voltage-dependent calcium channel α2δ1 subunitmediated chemotherapy resistance in small-cell lung cancerClin Cancer Res20182492148215829437792
- LiLHaoXQinJAntibody against CD44s inhibits pancreatic tumor initiation and postradiation recurrence in miceGastroenterology201414641108111824397969