Modification of the hTERT promoter by heat shock elements enhances the efficiency and specificity of cancer targeted gene therapy

Abstract

Purpose: One of the current challenges facing cancer gene therapy is the tumour-specific targeting of therapeutic genes. Effective targeting in gene therapy requires accurate spatial and temporal control of gene expression. To develop a sufficient and accurate tumour-targeting method for cancer gene therapy, we have investigated the use of hyperthermia to control the expression of a transgene under the control of the human telomerase reverse transcriptase (hTERT) promoter and eight heat shock elements (8HSEs). Materials and methods: Luciferase reporters were constructed by inserting eight HSEs and the hTERT promoter (8HSEs-hTERTp) upstream of the pGL4.20 vector luciferase gene. The luciferase activity of the hTERT promoter and 8HSEs-hTERT promoter were then compared in the presence and absence of heat. The differences in luciferase activity were analysed using dual luciferase assays in SW480 (high hTERT expression), MKN28 and MRC-5 cells (low hTERT expression). The luciferase activity of the Hsp70B promoter was also compared to the 8HSEs-hTERT promoter in the above listed cell lines. Lentiviral vector and heat-induced expression of EGFP expression under the control of the 8HSEs-hTERT promoter in cultured cells and mouse tumour xenografts was measured by reverse transcription polymerase (RT-PCR), Western blot and immunofluorescence assays. Results: hTERT promoter activity was higher in SW480 cells than in MKN28 or MRC-5 cells. At 43 °C, the luciferase activity of the 8HSEs-hTERT promoter was significantly increased in SW480 cells, but not in MKN28 or MRC-5 cells. Importantly, the differences in luciferase activity were much more obvious in both high (SW480) and low (MKN28 and MRC-5) hTERT expressing cells when the activity of the 8HSEs-hTERT promoter was compared to the Hsp70B promoter. Moreover, under the control of 8HSEs-hTERT promoter in vitro and in vivo, EGFP expression was obviously increased by heat treatment in SW480 cells but not in MKN28 or MRC-5 cells, nor was expression increased under normal temperature conditions. Conclusions: The hTERT promoter is a potentially powerful tumour-specific promoter and gene therapy tool for cancer treatment. Incorporating heat-inducible therapeutic elements (8HSEs) into the hTERT promoter may enhance the efficiency and specificity of cancer targeting gene therapy under hyperthermic clinical conditions.

• Gene therapy
• heat-inducible gene expression
• heat shock element (HSE)
• hTERT promoter
• hyperthermia

Introduction

Current gene therapies for cancer often cause severe side effects and have insufficient antitumour efficacy due to insufficient tumour targeting accuracy [1]. Tumour specific targeting is crucial to the success of gene therapy because expression of the therapeutic gene may be toxic to normal tissues. Therefore, one of the most important challenges facing the development of anti-cancer gene therapies is the development of targeting vectors that can efficiently drive the expression of the therapeutic gene in tumour cells while not inducing expression in normal cells. Gene targeting vectors that contain tumour-specific and inducible transcriptional elements may be a very effective method of targeting gene expression to tumour cells [2].

Hyperthermia has already been widely applied as an inducible anti-tumour treatment for the treatment of breast cancer, colorectal carcinomas and malignant melanomas [3–5]. In addition to sensitising tumour cells to radio- and chemotherapy, hyperthermia activates Hsp70 gene expression and can augment the effects of other therapeutic genes [6]. Therefore, the combination of hyperthermia and gene therapy holds great promise as a cancer treatment strategy. It is well known that hyperthermic activation of Hsp70 is regulated at the transcriptional level and that this regulation depends on heat shock elements (HSEs), short sequences in the Hsp70 promoter essential for heat inducibility [7]. Therefore, it is possible to introduce HSEs into a gene transfer vector to provide heat inducible control of a select therapeutic gene in a locally heated tumour [8].

Deregulation of human telomerase reverse transcriptase (hTERT) contributes to the hallmark unlimited proliferation potential of cancer cells. Approximately 90% of cancer cells express hTERT and have telomerase activity, whereas most normal cells do not express hTERT [9]. This indicates that the proliferation and survival of cancer cells depends on the constitutive activity of the hTERT promoter. Thus it is possible to restrict therapeutic gene expression to tumour cells by placing the desired therapeutic gene under the control of the hTERT promoter; however, the hTERT promoter is much weaker than many commonly used viral promoters such as the cytomegalovirus (CMV) early promoter and the simian virus 40 (SV40) early promoter [10]. This limitation caused us to hypothesise that the combination of heat shock elements (HSEs) with the hTERT promoter in a gene-targeting vector may increase the transcriptional activity of the hTERT promoter, significantly improving the ability of hTERT to drive the expression of therapeutic genes in a locally heated tumour.

In this study we developed a heat inducible promoter system by modifying the hTERT promoter with eight heat shock elements (8HSEs). We found that the 8HSEs-hTERT promoter efficiently drove the expression of the target gene in both cultured cancer cells and mouse tumour xenografts.

Methods

Cell culture and in vitro hyperthermia

Human colorectal cancer SW480 cells, gastric cancer MKN28 cells and lung fibroblast MRC-5 cells were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA). SW480 and MKN28 cells were cultured in RPMI 1640 supplemented with 10% fetal bovine serum (FBS), 100 IU/mL penicillin, 100 mg/mL streptomycin and 2 mM L-glutamine. MRC-5 cells were cultured in minimum essential medium (MEM) supplemented with 10% FBS, 2 mM L-glutamine and 100 IU/mL and 100 mg/mL of penicillin and streptomycin. Cells were grown at 37 °C in a humidified atmosphere containing 5% CO₂.

Cells were seeded into cell culture dishes and incubated at 37 °C for 24 h. After the initial 24 h incubation the cells were transferred to a cell culture incubator that was pre-adjusted to the appropriate temperature. After incubation for the desired time, cells were transferred back to the 37 °C incubator and incubated for several hours to recover from the heat treatment.

Construction of the luciferase reporter vectors and recombinant lentiviruses

Eight heat shock elements (HSEs) with optimised AGAACGTTCTAGAAC sequences [11] alternately separated by five base pairs (bp) were generated by oligonucleotide ligation. The eight HSE fragments and the hTERT promoter (295 bp) [12] were inserted upstream of the luciferase reporter pGL4.20 vector to get plasmid pGL4.20-8HSEs-hTERTp. A 492 bp [13] fragment of the human Hsp70B promoter core region was cloned into the pGL4.20 vector to assemble the traditional heat shock promoter construct pGL4.20-Hsp70Bp. Correct plasmid construction was verified by DNA sequencing.

Two recombinant lentiviruses (pLVX-8HSEs-hTERTp-EGFP-3FLAG (8HhE) and a negative control pLVX-Ubi-3FLAG (CON) containing the ubiquitin promoter were purchased from GeneChem (Shanghai, China). The recombinant lentivirus vector including the hTERT promoter modified by the artificial 8HSEs, the EGFP gene and a 3FLAG marker (pLVX-8HSEs-hTERTp-EGFP-3FLAG) was constructed using conventional recombinant techniques.

Establishment of stable lentivirus-transfected cell lines

SW480, MKN28 and MRC-5 cells were transfected with the 8HhE and negative control CON lentiviruses, equal transduction rates were optimised in each cell line before experiments according to the manufacturer’s instructions. After 72 h, lentivirus-carrying clones were selected for 15 days in medium containing 1 mg/mL puromycin (Life Technologies, Grand Island, NY, USA).

Detection of hTERT and EGFP mRNAs by RT-PCR

Total cellular RNA was extracted from 2 × 10⁶ cells using the RNeasy Mini kit (Qiagen, Valencia, CA, USA). The primer pairs used for RT-PCR were designed using Primer Premier 5 (PREMIER Biosoft International, Palo Alto, CA) and Oligo 6.0 (Molecular Biology Insights, Colorado Springs, CO), and synthesised by Sangon Biotech (Shanghai). β-actin was used as an internal control. PCR was performed using a 25 µL reaction mixture with 1 µL 100 nM primers and 12.5 µL Taq DNA polymerase buffer (TaKaRa, Dalian, China). The primers were as follows:

• hTERT (PCR product: 150 bp)

• forward: 5’- ATCAGACAGCACTTGAAGAG -3’

• reverse: 5’- GTAGTCCATGTTCACAATCG -3’

• EGFP (PCR product: 73 bp)

• forward: 5’- ACGACTTCTTCAAGTCCGCC -3’

• reverse: 5’- CTGTAGTGCCGTCGTCTGAG -3’

• Hsp70 (PCR product: 141 bp)

• forward: 5’- CACCACCTACTCGGACAACC -3’

• reverse: 5’- TCTATCTGGGGGACTCCACG -3’

• HSTF1 (PCR product: 152 bp)

• forward: 5’- ACCGCCCTCATTGACTCCAT -3’

• reverse: 5’- CAGGCTACGCTGAGGCACTT -3’

• β-actin (PCR product: 151 bp)

• forward: 5’- CTTAGCACCCCTGGCCAAG -3’

• reverse: 5’- GATGTTCTGGAGAGCCCCG -3’

• Mouse-β-actin (PCR product: 772 bp)

• forward: 5’- CCCCTGAACCCTAAGGCCA -3’

• reverse: 5’- CGGACTCATCGTACTCCTGC -3’

The hTERT PCR reaction mixture was denatured at 94 °C for 3 min followed by 30 cycles at 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 60 s. The EGFP PCR reaction mixture was denatured at 94 °C for 3 min followed by 25 cycles at 94 °C for 30 s, 57 °C for 30 s, and 72 °C for 30 s. The HSTF1 PCR reaction mixture was denatured at 94 °C for 3 min followed by 30 cycles at 94 °C for 30 s, 60 °C for 30 s, and 72 °C for 60 s. The Hsp70 PCR reaction mixture was denatured at 94 °C for 3 min followed by 30 cycles at 94 °C for 30 s, 61 °C for 30 s, and 72 °C for 60 s. The PCR product was analysed by 1.5% agarose gel electrophoresis in TAE buffer containing 0.2 mg/mL ethidium bromide. All PCR products were analysed by Image Lab version 4.1 software (Bio-Rad Laboratories, Hercules, CA) [14–16].

Analysis of hTERT and heat-induced EGFP expression by Western blotting

All protein samples were harvested from log-phase cells in cell lysis buffer containing 40 mM Tris-HCl (pH 6.9), 2 mM ethylenediaminetetraacetic acid (EDTA), 100 mM sodium fluoride, 150 mM NaCl, 10 mM sodium pyrophosphate, 1% Nonidet P40 (NP-40), 2 mM orthovanadate, 1% Triton X-100, 0.3 mM phenylmethanesulphonyl fluoride and 1 protein inhibitor mini-tablet (Roche, Shanghai). Protein concentration was estimated using a Pierce Protein Estimation System (Thermo Fisher Scientific, Waltham, MA) according to the manufacturer’s protocol. 30 µg protein was heated at 95 °C for 5 min in loading buffer containing 0.1 M Tris-HCl, 1.5% SDS, 2% glycerol, 1% β-mercaptoethanol and 0.01% bromophenol blue. Equal amounts of protein were separated on a 10% SDS PAGE gel and transferred onto polyvinylidene difluoride membranes by wet transfer. Non-specific binding was blocked for 1 h at 37 °C using 10% fat-free milk in TBS containing 0.1% Tween-20. Membranes were probed overnight at 4 °C with primary antibodies (Rabbit anti-hTERT and anti-3FLAG, 1:2000 dilution; Sigma, Shanghai, China; Rabbit anti-HSTF1 and mouse anti-Hsp70, 1:1000 dilution, Proteintech, Chicago, IL). After washing three times with TBST, membranes were incubated with horseradish peroxidase (HRP)-labelled secondary antibodies (Proteintech) at room temperature for 1 h. Immunobands were detected using SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific) and exposure to ChemiDoc XRS+ (Bio-Rad).

Immunofluorescence

Twenty-four hours after the 37 °C or 43 °C temperature treatments, six stable lentivirus-transfected cell lines were fixed in 4% paraformaldehyde, blocked in 5% bovine serum albumin and incubated with a monoclonal anti-FLAG antibody (1:150, Sigma) for 1 h. Next, cells were incubated with FITC-conjugated goat anti-rabbit antibody (eBioscience, San Diego, CA, USA) at a 1:100 dilution. Cells were then washed and incubated in 4, 6-diamidino-3-phenylindole dihydrochloride hydrate (DAPI, 1:10000) for 5 min. Primary antibody omission was employed as a negative control. After rinsing with distilled water, slides were mounted with glycerol and examined under a fluorescent microscope.

Dual luciferase assay

Cells were seeded in 96-well plates at a density of 5000 cells/well. The next day, cells were transfected with 150 ng luciferase reporter plasmid (pGL4.2-hTERTp, pGL4.2-8HSEs-hTERTp or pGL4.2-Hsp70Bp) and 30 ng of pGL-4.74 (containing the TK promoter; Promega, Madison, WI) as an internal control using the TurboFect™ Transfection Reagent (Thermo Fisher Scientific) according to the manufacturer’s instructions. After transfection for 10 h, the mixture was replaced with fresh medium. After 48 h, cells were subjected to heat treatments. Luciferase assays were performed 6 h later using a Dual-Glo® luciferase assay system kit (Promega). In brief, 100 µL of Dual-Glo luciferase assay reagent was added to each well, followed by the addition of 100 µL Dual-Glo Stop & Glo® reagent. The Renilla luminescence was normalised to the internal control vector pGL-4.74 luminescence. Promoter activities were measured as relative luminescence units (RLU) where the value of the firefly luciferase luminescence of pGL-4.20 was divided by the Renilla luciferase pGL-4.74 in the same well.

Mouse tumour xenograft lentiviral transduction

SW480 cells were subcutaneously injected into the left dorsal legs of BALB/c female mice. Fifteen mice were randomly divided into three groups: negative control, 8HhE and heat-treated 8HhE (43 °C water bath for 1 h). After approximately 20 days (or when the xenograft tumours reached 120 mm³), the mice received tail vein injections of 8 × 10⁶ pfu of virus twice per day for three days. On the 11th and 13th days post-inoculation, the mice were placed in a 43 °C water bath for 1 h. The four feet of the mice were tied to the four nails on a board which ensured the mouse transplanted tumour parts were immersed in the water bath. On day 14, tumours and major organs, including the colon, lungs, kidneys, liver, heart and muscles, were harvested to measure EGFP mRNA expression. Organs and tissues were ground to a fine powder with a mortar and pestle. Total RNA was extracted using the RNeasy Mini kit according to the manufacturer’s instructions [14–16]. The experimental protocol was approved by the Ethical Committee and the Institutional Animal Care and Use Committee of Xi’an Jiaotong University.

Statistical analysis

Results are shown as means ± standard error. Differences were evaluated with unpaired two-tailed Student’s t-tests with unequal variance for multiple comparisons using SPSS software (SPSS Statistics for Windows, Version 17.0, IBM, Chicago, IL, USA). p < 0.05 was considered statistically significant. All experiments were independently repeated at least three times.

Results

Optimal heat shock conditions for the 8HSEs-hTERTp promoter in SW480 cells expressing high levels of hTERT

To examine the heat-induced luciferase activity of pGL4.2-8HSEs-hTERTp, we transfected SW480 cells, which express a high level of hTERT, with pGL4.2-8HSEs-hTERTp and the internal control vector pGL-4.74 for 48 h. The cells were heat treated for 1 h, and luciferase activity was assessed at different temperatures ranging from 37–44 °C and at various time points after heat treatment. We observed that heat treatment induced the luciferase activity in a temperature-dependent manner (Figure 1A). Low levels of luciferase activity were detected at 39–41 °C, while significant luciferase induction was observed after incubation at 43 °C (327-fold) and 44 °C (347-fold). This result is in agreement with a previous report indicating that 43 °C treatment significantly increased luciferase activity without obviously affecting cell viability [17]. Therefore, because of the high promoter induction and good survival rate at this temperature, we chose 43 °C as the optimal temperature. We next treated the cells at 43 °C for different lengths of time and observed a relatively high level of luciferase activity after 1 h at 43 °C (Figure 1B). Furthermore, the luciferase activity of hyperthermically treated cells peaked 6 h after being treated for 1 h at 43 °C, and the luciferase levels remained elevated for 6 to 10 h. Luciferase activity finally decreased to near basal levels after 48 h (Figure 1C). These results indicated that the optimal induction conditions for the hTERT promoter were 43 °C hyperthermic treatment for 1 h followed by 6 h recovery.

Figure 1. Optimal heat shock condition determination for the 8HSEs-hTERTp promoter. (A) SW480 cells were incubated at 37–44 °C for 1 h to induce a heat shock response, Luciferase activity was measured 6 h after the heat treatment. The luciferase activity levels were recorded as relative luminescence units (RLU). (B) SW480 cells were incubated for 0.5, 1, 2 and 3 h at 43 °C. Luciferase activity was measured 6 h after heat treatment. (C) SW480 cells were incubated at 43 °C for 1 h and luciferase activity was determined 2, 6, 10, 24 and 48 h after the heat treatment. Error bars: mean ± SD, n = 6.

The luciferase activity of pGL4.2-hTERTp and pGL4.2-8HSEs-hTERTp at 37 °C is higher in cells with high hTERT expression when compared to cells with low hTERT expression

To test whether the induction of the ectopic hTERT promoter depends on endogenous hTERT activity, we compared the luciferase activity levels of pGL4.2-hTERTp and pGL4.2-8HSEs-hTERTp in SW480, MKN28 and MRC-5 cells. To establish the level of endogenous hTERT activity in each of these cell lines we measured hTERT mRNA and protein expression using RT-PCR, Western-blot and immunocytochemistry. hTERT mRNA levels were significantly higher in SW480 cells when compared to both MKN28 and MRC-5 cells (Figure 2A and B). Similarly, immunohistochemistry analysis showed significantly stronger hTERT staining in SW480 cells when compared to MKN28 and MRC-5 cells (Figure 2C and D). Finally, Western blots indicated that there were increased hTERT protein levels in SW480 cells when compared with MKN28 and MRC-5 cells (Figure 2E and F).

Figure 2. hTERT mRNA and protein expression in SW480, MKN28 and MRC-5 cells. (A) hTERT mRNA was detected by RT-PCR in SW480, MKN28 and MRC-5 cells. (B) Integrated optical density was measured to evaluate hTERT mRNA expression relative to the expression of β-actin. (p* and p** < 0.05 by Student’s t-test with equal variance). (C) Immunocytochemistry staining of hTERT in SW480, MKN28 and MRC-5 cells. Magnification, ×400. (D) The grey values for the immunocytochemistry staining were calculated by ipp6 software. (p* and p** < 0.05 by Student’s t-test with equal variance). (E) Western-blotting detection of hTERT protein in SW480, MKN28 and MRC-5 cells. (F) Integrated optical density was measured to evaluate hTERT protein expression relative to the expression of β-actin. (p* and p** < 0.05 by Student’s t-test with equal variance).

Next, we transfected SW480, MKN28 and MRC-5 cells with pGL4.2-hTERTp or pGL4.2-8HSEs-hTERTp at 37 °C for 48 h and measured luciferase activity. Higher levels of luciferase activity were observed in SW480 cells when compared with MKN28 and MRC-5 cells (pGL4.2-hTERTp versus pGL4.2-8HSEs-hTERTp in SW480 cells, p* = 0.196; pGL4.2-hTERTp versus pGL4.2-8HSEs-hTERTp in MKN28 cells, p** = 0.627; pGL4.2-hTERTp versus pGL4.2-8HSEs-hTERTp in MRC-5 cells, p*** = 0.008, Figure 3A). These results indicate that the hTERTp and 8HSEs-hTERTp promoters could be efficiently targeted to cells with high endogenous hTERT expression levels.

Figure 3. Luciferase reporter gene expression driven by the hTERT promoter, 8HSEs-hTERTp promoter or HSP70B promoter. (A) SW480, MKN28 and MRC-5 cells were transfected with pGL4.2-hTERTp or pGL4.2-8HSEs-hTERTp for 48 h, and then incubated at 37 °C for 1 h. Cells were co-transfected with pGL4.74 as an internal control. The promoter activity was recorded as relative luminescence units (RLU), where the value of the pGL4.20 firefly luciferase luminescence was divided by the pGL4.74 Renilla luciferase expressed in the same well. The data are expressed as means ± SD (n = 6). (p* = 0.196, p** = 0.627, p*** = 0.008 by Student’s t-test with equal variance). (B) SW480, MKN28 and MRC-5 cells were transfected with pGL4.2-8HSEs-hTERTp, and then incubated at 37 or 43 °C for 1 h. The data are expressed as means ± SD (n = 6). (p* = 0.007, p** = 0.219, p*** = 0.858 by Student’s t-test with equal variance). (C) SW480, MKN28 and MRC-5 cells were transfected with pGL4.2-HSP70Bp or pGL4.2-8HSEs-hTERTp, and then incubated at 37 °C or 43 °C for 1 h. The data are expressed as means ± SD (n = 6).

8HSEs increase luciferase activity of the hTERT promoter after heat treatment

To determine whether synthetic HSEs could increase the transcriptional activity of the hTERT promoter after heat treatment, we transfected SW480, MKN28 and MRC-5 cells with pGL4.2-8HSEs-hTERTp. Transfected cells were treated at either 43 °C or 37 °C for 1 h and the resultant luciferase activity was measured. Treatment at 43 °C for 1 h significantly increased the luciferase activity of SW480 but not MKN28 or MRC-5 cells (37 °C versus 43 °C in SW480 cells, p* = 0.007; 37 °C versus 43 °C in MKN28 cells, p** = 0.219; 37 °C versus 43 °C in MRC-5 cells, p*** = 0.858, Figure 3B). Contrastingly, 37 °C treatment resulted in no apparent differences in luciferase activity among these cell lines (Figure 3B). These results demonstrate that the artificial 8HSEs could significantly enhance the transcriptional activity of the hTERT promoter in cells expressing high endogenous hTERT levels (SW480), and this enhanced transcriptional activity was only observed under heat treatment conditions.

Under heat treatment conditions, 8HSEs-hTERTp has better tumour cell transcriptional specificity than the Hsp70B promoter

To compare the transcriptional activity of the 8HSEs-hTERT promoter with the Hsp70B promoter under heat treatment conditions, we transfected SW480, MKN28 and MRC-5 cells with pGL4.2-8HSEs-hTERTp or pGL4.2-Hsp70Bp. Transfected cells were treated at either 43 °C or 37 °C for 1 h, and the resultant luciferase activity was measured 6 h after treatment. After the 37 °C treatment, luciferase activity in all three pGL4.2-Hsp70Bp transfected cell lines was very low; however, after the 43 °C treatment, luciferase activity was highly induced (Figure 3C). This indicated, as expected, that Hsp70B promoter induction depended on hyperthermia. In contrast, the luciferase activity of pGL4.2-8HSEs-hTERTp was only drastically induced by 43 °C treatment in SW480 cells (Figure 3C). This demonstrated that 8HSEs-hTERTp activity was reliant on both heat treatment and high endogenous hTERT expression levels. These results indicated that pGL4.2-8HSEs-hTERTp should have a higher specificity for tumour cells or other cells with high endogenous hTERT when compared with pGL4.2-Hsp70Bp at 43 °C.

Heat-directed gene targeting of a lentiviral vector in vitro

To investigate heat-directed gene therapy targeting in vitro, lentivirus 8HhE containing the EGFP gene under the control of 8HSEs-hTERTp was constructed and transduced into SW480, MKN28 and MRC-5 cells. After 1 h of 43 °C treatment, EGFP mRNA and protein levels were analysed by RT-PCR, Western blotting and immunofluorescence staining (mRNA analysed 6 h later and protein 24 h later). In contrast with control lentivirus transduced cells, cells transduced with 8HhE demonstrated EGFP mRNA expression at 37 °C that was significantly enhanced after 1 h of 43 °C treatment (Figure 4). This enhanced expression was particularly significant in SW480 cells. Western blots showed a dramatic induction of EGFP protein in SW480 but not in MKN28 or MRC-5 cells by 8HhE after 1 h of 43 °C treatment (Figure 5). Additionally, immunofluorescence analyses demonstrated that, of all the cells examined, only SW480 cells transduced with 8HhE showed strong green fluorescence at 37 °C, and this fluorescence was further enhanced after 1 h of 43 °C treatment (Figure 6).

Figure 4. RT-PCR analysis of HSTF1, Hsp70 and EGFP gene expression. SW480, MKN28 and MRC5 cells were transfected with the control lentivirus (pLVX-Ubi-3FLAG) or the 8HSEs-hTERTp-EGFP lentivirus (pLVX-8HSEs-hTERTp-EGFP-3FLAG). The cells were incubated at 37 or 43 °C for 1 h. Infected and uninfected cells were harvested 6 h after heat treatment. mRNA expression of the HSTF1, Hsp70 and EGFP genes were monitored by RT-PCR. Integrated optical density was measured to evaluate target gene expression relative to β-actin expression.

Figure 5. Western-blotting analysis of HSTF1, Hsp70 and EGFP protein expression. SW480, MKN28 and MRC5 cells were transfected with the control lentivirus (pLVX-Ubi-3FLAG) or the 8HSEs-hTERTp-EGFP lentivirus (pLVX-8HSEs-hTERTp-EGFP-3FLAG). The cells were incubated at 37 or 43 °C for 1 h. Infected and uninfected cells were harvested 24 h after heat treatment. The protein levels of HSTF1, Hsp70 and EGFP were assessed by Western-blotting. Integrated optical density was measured to evaluate protein expression relative to β-actin expression.

Figure 6. EGFP protein immunofluorescence (anti-3FLAG). SW480, MKN28 and MRC5 cells were transfected with the control lentivirus (pLVX-Ubi-3FLAG) or the 8HSEs-hTERTp-EGFP lentivirus (pLVX-8HSEs-hTERTp-EGFP-3FLAG). The cells were incubated at 37 or 43 °C for 1 h.The infected cells were harvested 24 h after heat treatment and EGFP protein was monitored by immunofluorescence with anti-3FLAG antibody. Magnification ×400.

We further analyed the expression of HSTF1 and Hsp70 at the mRNA and protein levels by RT-PCR and Western blotting. Heat treatment at 43 °C for 1 h led to enhanced Hsp70 mRNA levels in SW480 and MRC-5 cells (Figure 4). Furthermore, Hsp70 protein levels were significantly induced after 1 h heat treatment at 43 °C in all three cell lines (Figure 5). Additionally, both mRNA (Figure 4) and protein (Figure 5) levels of HSTF1 were elevated after 1 h of 43 °C treatment in all three cell lines. These results demonstrated that 8HSEs-hTERTp could only significantly induce EGFP at the transcriptional and translational levels in heat-treated high endogenous hTERT expressing SW480 cells. Furthermore, these results indicated that 8HSEs-hTERTp enhanced the specificity of EGFP gene expression in cancer cells.

Heat-directed gene targeting of lentiviral vectors in a mouse tumour xenograft model

To examine heat-directed gene therapy targeting in vivo, SW480 cells were subcutaneously injected into the hind limbs of BALB/C nude mice. When the xenograft tumours reached 120 mm³, 8 × 10⁶ pfu of lentivirus 8HhE was injected via the tail vein twice per day for 3 days. Twenty-four hours after the last injection, the tumours were heated to 43 °C for 1 h in a water bath [18]. Twenty-four hours following heat treatment, the mice were sacrificed and tumour, liver, heart, lung, intestine, kidney and muscle tissues were removed for assessment [19]. No detectable EGFP mRNA was observed in the tumours under normal growth conditions (Figure 7). In contrast, significant EGFP expression was observed in tumours heated to 43 °C. However, no detectable EGFP mRNA could be seen in any of the distant organs tested, nor was EGFP mRNA detected in a tumour treated with PBS via the tail vein. These results demonstrate the feasibility of heat-directed gene expression in vivo.

Figure 7. RT-PCR of EGFP mRNA in vivo. SW480 mouse tumour xenografts were injected with lentivirus pLVX-8HSEs-hTERTp-EGFP-3FLAG for 48 h. mRNA was extracted from the tumour and various organs. The mRNA level of EGFP was analyzed by RT-PCR. The mRNA levels of EGFP in tumours treated at 37 °C were obviously lower than the mRNA levels of tumours treated at 43 °C. SW480 transfected by the pLVX-8HSEs-hTERTp-EGFP-3FLAG vector served as the positive control. No detectable PCR products were found in any of the various organs tested, nor in a tumour treated with PBS via the tail vein.

Discussion

In this study we showed that, after heat treatment, the 8HSEs-hTERTp promoter drove transgene expression more efficiently than either the hTERT promoter or the Hsp70B promoter in hTERT overexpressing SW480 cells in vivo and in vitro. Our results suggest that incorporating the 8HSEs-hTERTp promoter into lentiviral vectors could improve gene expression inducibility and specificity in cancer cells under hyperthermic conditions.

Gene therapy is a promising alternative strategy for cancer treatment [20]. However, due to insufficient targeting specificity, current therapeutic genes can induce substantial toxicity in normal tissues. Therefore, achieving efficient and specific tumour targeting is a major challenge that must be overcome in the development of anti-cancer gene therapies. Several methods of improving tumour targeting, such as vector targeting and tissue-specific gene expression, have been investigated and have achieved varying degrees of success [21,22]. One strategy that can enhance the specificity of therapeutic gene targeting is the use of tumour-specific gene promoters. Previous studies have investigated a number of tumour-specific promoters in a variety of models with promising results. These include the CEA promoter in CEA-positive lung carcinoma [23], the AFP promoter in AFP positive hepatocellular carcinoma [24] and the stress-inducible grp78/BiP promoter in fibrosarcoma [25]. One promising tumour-specific promoter that has been demonstrated to target a broad range of cancer types is the hTERT promoter [26]. In this study, we observed that the transcriptional activity of the hTERT promoter was much higher in high hTERT expressing SW480 cells when compared with low hTERT expressing MKN28 and MRC-5 cells. However, although the hTERT promoter could drive tumour specific gene expression, the transcriptional activity of hTERT was very low in most cancer cells. To augment hTERT promoter-driven gene expression in tumour cells, we combined the hTERT promoter with eight heat shock elements (8HSEs). Luciferase assays revealed that, after heat treatment, the 8HSEs-hTERTp promoter induced luciferase gene expression more strongly than the hTERT promoter. Furthermore, this enhanced activity was restricted to heat treated tumour cells. Additionally, our results demonstrated that an 8HSEs-hTERTp promoter induced EGFP gene could be more efficiently induced in high hTERT-expressing tumour cells (SW480) when compared with low hTERT-expressing tumour cells (MKN28) or benign cells (MRC-5).

HSEs have been demonstrated to be necessary for the heat stress inducibility of the Hsp70B promoter, which has been widely used in cancer gene therapy as a tumour-specific and inducible promoter [27]. The luciferase assay results of the current study demonstrate that the 8HSEs efficiently initiated hTERT promoter activity in heat-treated SW480 cells and led to more tumour-specific expression than the Hsp70B promoter. Our study suggests that the 8HSEs-hTERTp promoter may be more efficient than the Hsp70B promoter for tumour targeting during hyperthermic therapy.

Previous studies have shown that HSTF1 expression could transactivate endogenous HSE elements upstream of the Hsp70 gene under heated conditions, which is a very important ability in heat-responsive gene therapy [28]. HSTF1 expression is regulated by Hsp90, HSBP-1 [29], the MAPK pathway and p53/WT-1 [30,31]. Consistent with the transcriptional activities of the 8HSEs-hTERTp promoter, we found that heat treatment resulted in up-regulation of the mRNA and protein levels of both HSTF1 and Hsp70 in all three cell lines examined. These results indicated that 8HSEs-hTERTp heat treatment transactivation depended on HSTF1 and Hsp70. The HSTF-1 dependent mechanisms through which heat shock leads to HSE-dependent induction of gene expression remain to be determined.

To investigate our in vitro observation that the 8HSEs-hTERTp promoter was capable of inducing tumour-specific gene expression in vivo, we tested EGFP gene expression following tumour heat treatment in a mouse tumour xenograft model injected with a heat-inducible lentiviral vector. In addition to high gene expression targeting efficiency, the 8HSEs-hTERTp promoter exhibited strict specificity for tumour tissues. Supporting this apparent specificity, EGFP expression was undetectable in normal tissues from various organs. These results suggest that the inclusion of 8HSEs-hTERTp in a gene-targeting vector might be a promising method of targeting gene expression during tumour treatment by clinical hyperthermia.

Temperature is a controllable physical parameter [32]. In modern clinical applications, the almost uniform temperature of local overheating is the ideal state to regulate gene expression, but it is very difficult to obtain. Several methods have been established to induce such a local hyperthermia in patients and have been applied as a combination of radiotherapy and chemotherapy for the treatment of tumours [33,34]. For superficial hyperthermia, simple water bath or microwave therapy is suitable [35]. Focused ultrasound may be more suitable for deep tissue hyperthermia and has been applied for activation of Hsp70 promoters in gene therapy [36,37]. We selected the 43 °C water bath as a means of implementation of xenograft tumour tissue in nude mice. Lower temperatures do not activate therapeutic gene expression, while increasing the local tumour blood supply, which may promote the growth of tumour blood metastasis and cell growth [38]. The effect of hyperthermia can be achieved by fixing the mouse subcutaneous tumour tissue in 43 °C water, but it was very difficult to keep the temperature of the tumour tissue at a uniform 43 °C. Future investigations are necessary to establish a method to keep a uniform tumour tissue temperature, which is important in the practical applications of hyperthermia for cancer treatment.

In summary, we have demonstrated efficient heat-targeted lentiviral gene expression in vivo and in vitro. Inclusion of 8HSEs in the hTERT promoter significantly improved hTERT inducibility and responsiveness to heat treatment in cultured cancer cells. 8HSEs-hTERTp responsiveness was especially notable in cancer cells with high endogenous expression of hTERT. Furthermore, 8HSEs-hTERTp appeared to improve the tumour tissue specificity of lentiviral vector0induced gene expression in a tumour xenograft model. Our study suggests that current hyperthermia treatment technology could be used to direct recombinant viruses bearing highly toxic genes to their target tumours under the control of the 8HSEs-hTERTp promoter.

Declaration of interest

This work was supported by grants from the National Natural Science Foundation of China (No. 81172362 and No. 81172359), a Science and Technology Project of Shaanxi Province (Grant serial number 2011-K12-19), a Clinical Innovation Fund of the First Affiliated Hospital of Xi’an Jiaotong University (grant serial numbers 12ZD12 and 12ZD21), and the Coordinative and Innovative Plan Projects of Science and Technology in Shaanxi Province (number 2013KTCQ03-08). The authors alone are responsible for the content and writing of the paper.