Combination therapy of Chinese herbal medicine Fructus Ligustri Lucidi with high calcium diet on calcium imbalance induced by ovariectomy in mice

Abstract

Context: Our previous biological study demonstrated that Fructus Ligustri Lucidi (FLL), the fruit of Ligustrum lucidum Ait. (Oleaceae), could be used to maintain calcium balance and prevent age-related osteoporosis since it effectively decreased calcium loss and increased calcium retention in rats.

Objective: This study investigates the combination effect of the Chinese herbal medicine FLL and a high calcium diet on calcium imbalance induced by ovariectomy in mice.

Materials and methods: The ovariectomized (OVX) mice were orally treated with vehicle, FLL extract (700 mg/kg), milk powder (5 g/mice) fortified with calcium (1.0% Ca) and the combination of FLL with milk powder. After 6 weeks of treatment, urine, serum, and tibia were preserved for biochemical analysis and kidneys were taken for gene expression analysis.

Results: The combination treatment of FLL and a high calcium diet significantly increased bone calcium content (6.80 ± 0.34 mg) by 22% (p < 0.05) and decreased urine calcium excretion (0.099 ± 0.009 mg/mg) by 62% (p < 0.01) as compared with those of the OVX group (bone Ca, 5.57 ± 0.31 mg; urine Ca/Cr, 0.261 ± 0.017 mg/mg). The mRNA expression of renal calcium-binding protein-9k (CaBP-9k) and calcium-sensing receptor (CaSR) in combination treatment group was significantly up-regulated and down-regulated, respectively, as compared with those of the OVX group.

Conclusion: The beneficial effects of this combination therapy on calcium balance of OVX mice were, at least partially, attributed to its regulation on mRNA expression of CaBP-9k and CaSR in kidney.

• Bone
• calcium-sensing receptor
• estrogen deficiency
• kidney

Introduction

Osteoporosis (OP) is a disease characterized by a low bone mass density (BMD) and a structural deterioration of bone tissue which in most cases lead to bone fragility and increase of susceptibility to fractures (Epstein, 2006). Most cases of osteoporosis occur in postmenopausal women due to dramatic estrogen withdrawal with the declining of ovarian function (Bedell et al., 2014).

Bones are the body's reservoir of calcium. Calcium is mobilized from bone by the action of calcium-regulating hormones when calcium homeostasis drops; consequently, it causes the increased bone fragility (de Villiers, 2009; Greer & Krebs, 2006). The negative calcium balance associated with vitamin D deficiency when ageing initiates the increase of parathyroid hormone (PTH) secretion which in turn initiates the decrease of BMD (Norenstedt et al., 2014). In case of calcium imbalance, the parathyroid gland receives signals from calcium-sensing receptor (CaSR) and then PTH is released into the circulation. PTH initiates the conversion of 25-hydroxyvitamin D to 1,25-dihydroxyvitamin D by up-regulating the expression of 1-hydroxylase in kidney. The production of vitamin D in the active form stimulates the reduction of calcium excretion from urine and the liberation of calcium from skeleton into the circulation. The resulting increase of calcium in blood restores calcium balance and finally exerts a feedback on parathyroid gland to inhibit further release of PTH (Zhang et al., 2007).

CaSR serves as a sensor of the extracellular calcium level in different tissues and plays a key role in the regulation of secretion of calciotropic hormones, like PTH and calcitonin. The emerging evidence points to a role for the CaSR in regulating extracellular calcium homeostasis (Cheng, 2012; Riccardi & Brown, 2010). In kidney, the reabsorption of calcium in response to CaSR activation is inhibited (Ba & Friedman, 2004). Additionally, calcium binding protein-9k (CaBP-9k), one of the active calcium transporters in kidney, is responsible for apical Ca influx and intracellular diffusion (Ko et al., 2009).

Estrogen deficiency induces calcium loss by decreasing the calcium absorption in intestine and the calcium conservation in kidney (Zhang et al., 2007). Adequate dietary calcium intake is important for the accretion of peak bone mass, which is highly correlated with the development of osteoporosis in later life (Tucker, 2003). The intake of calcium from milk or supplements contributes to the positive calcium balance and a trend toward an increased rate of gain in BMD (Johnston et al., 1992).

Estrogen replacement therapy (ERT) has been used to prevent osteoporosis of postmenopausal women (Bedell et al., 2014), but many side-effects associated with ERT application have been reported, such as the increase of the risk of endometrial, breast and ovarian cancers, thromboembolic events, vaginal bleeding, etc. (Beral, 2003; Lacey et al., 2002). Medicinal plants and natural products were proved to be the potential alternative to ERT for the management of osteoporosis (Doyle et al., 2009; Penolazzi et al., 2008). Chinese herbal medicines (CHMs), which have been used to treat bone diseases for thousands of years, are believed to be a cost-effective alternative to commercial pharmaceutical products (Qin et al., 2005), and have achieved many effects on the prevention and treatment of osteoporosis (Qin et al., 2005; Zhang & Li, 2012).

Fructus Ligustri Lucidi (FLL), the fruit of Ligustrum lucidum Ait. (Oleaceae), is a kidney-tonifying herb for treating aged-related diseases, and is commonly prescribed for detoxifying kidneys and strengthening bones (Zhang et al., 2008). Our previous biological study demonstrated that FLL could be used to maintain calcium balance and prevent age-related osteoporosis since it effectively decreased calcium loss and increased calcium retention in rats (Zhang et al., 2006). The objective of the present study was to evaluate the combination effect of FLL and a high calcium diet (milk powder with fortified calcium) on calcium balance in ovariectomized mice, an animal model for postmenopausal osteoporosis.

Materials and methods

Preparation of FLL extract

Fructus Ligustri Lucidi (FLL) was obtained from Jiangsu province of China in March 2013 and authenticated according to a method listed in Chinese Pharmacopeia with the help of Professor Lianzhong Ai (State Key Laboratory of Dairy Biotechnology, Shanghai, China). A voucher specimen was deposited in State Key Laboratory of Dairy Biotechnology (Shanghai, China). The dried and powdered (10 kg) crude plant was extracted with 70% ethanol two times, the preparation was filtered and concentrated under vacuum to produce a viscous residue at a yield of 32%, by weight of the starting materials.

Animal treatment

About 10-week-old female ICR mice (Slac Laboratory Animal, Shanghai, China) were allowed to acclimate to their environment for 1 week before surgery. The acclimatized mice underwent either laparotomy and closure (Sham group, n = 8) or laparotomy and bilateral oophorectomy (OVX group, n = 32) after anesthetization with a mixture of ketamine:xylazine (80:10 mg/kg). After 1 week of recovering from surgery, the ovariectomized (OVX) mice were randomly divided into four groups of eight: vehicle-treated (OVX), FLL-treated (OVX +F ), calcium-fortified (1.0% Ca) milk powder-treated (5 g/mice, OVX + M), and the combination of FLL and milk powder (OVX + FM). FLL was orally administered at dosage of 700 mg/kg as described previously (Dong et al., 2012; Zhang et al., 2008).

After 6 weeks of treatment, the urine was collected and kept at −80°C. At sacrifice, the serum and tibias were preserved for biochemical analysis while kidneys were preserved at −80°C for gene expression analysis. The animal study protocol was reviewed and approved by the institution's Animal Ethics Committee at the University of Shanghai for Science and Technology.

Serum and urine chemistries

Calcium²⁺ (Ca²⁺) and creatinine (Cr) concentrations of serum and urine were measured by standard colorimetric methods using a micro-plate reader (Bio-Tek, Center Valley, PA). The level of urine Ca was corrected by the concentration of urine Cr.

Bone calcium content

The left tibias were incinerated at 800°C for 12 h and the ash weighed. About 10 mg of bone ash was then dissolved in 2 ml of 37% HCl and diluted with Millin-Q water. The calcium content was determined by the kit used for calcium assay in serum and urine.

RT-PCR

The RNA extraction from kidney was performed according to the TRIzol manufacturer's protocol (Invitrogen, Carlsbad, CA). RNA integrity was verified by agarose gel electrophoresis. The preparation of cDNAs was performed by reverse transcription reactions with 4 μg of total RNA using moloney murine leukemia virus reverse transcriptase (Invitrogen, Carlsbad, CA) and oligo dT₍₁₅₎ primers (Fermentas, Hanover, MD) as described by the manufacturer. The first strand cDNAs served as the template for the regular PCR performed using a DNA Engine (ABI, Cold Spring Harbor, NY). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an internal control was used to normalize the data to determine the relative expression of the target genes. The PCR primers used in this study are shown in Table 1.

Table 1. Primer sequences.

Gene	Sequence (5′→3′)	Product size (bp)
CaBP-9k	Forward: CAAAAATATGCAGCCAAGGA Reverse: AGCGTGCGTTCAATCAGTAG	249
CaSR	Forward: ATTTTCCTGACCGCCTTTGT Reverse: GGACTCGATTGGTCTTCACC	238
GAPDH	Forward: CAGAACATCATCCCTGCATC Reverse: CTGCTTCACCACCTTCTTGA	183

CaBP-9k, calcium binding protein-9k; CaSR, calcium-sensing receptor; GAPDH, glyceraldehyde-3-phosphate-dehydrogenase.

Statistical analysis

The data from these experiments were reported as mean ± standard error of mean (SEM) for each group. The statistical analysis was performed using PRISM version 4.0 (GraphPad, GraphPad Software, San Diego, CA). Inter-group differences were analyzed by one-way ANOVA, and followed by Tukey's multiple comparison test as a post-test to compare the group means if overall p < 0.05. The difference with p value of less than 0.05 was considered statistically significant.

Results and discussions

When comparing the results of serum, urine and bone between Sham and OVX groups (Table 2), the content of serum Ca²⁺ (9.35 ± 0.32–9.07 ± 0.42 mg/dl) and bone calcium (6.18 ± 0.28–5.57 ± 0.31 mg) was decreased, and the excretion of urine Ca²⁺ (0.194 ± 0.020–0.261 ± 0.017 mg/mg) was significantly increased (p < 0.05). The treatment with FLL could significantly inhibit the high urinary Ca²⁺ excretion of OVX mice (p < 0.05), even though the content of serum Ca²⁺ and bone calcium of OVX mice upon to FLL treatment alone was not statistically different from those in the OVX group. These results were consistent with our previous reports which showed that FLL improved calcium balance by suppressing urine Ca²⁺ level of OVX rats (Zhang et al., 2006) and aged female rats (Zhang et al., 2008). The single treatment with milk powder containing high calcium could not alter the calcium content in serum, urine, and bone of OVX mice, suggesting that although the OVX mice received a high calcium diet, the decrease of bone calcium content was not addressed.

Table 2. Calcium level in serum, urine, and tibia.

	Serum Ca (mg/dl)	Urine Ca/Cr (mg/mg)	Ca/Ash (mg/mg)	Bone Ca (mg)
Sham	9.35 ± 0.32	0.194 ± 0.020	0.371 ± 0.017	6.18 ± 0.28
OVX	9.07 ± 0.42	0.261 ± 0.017#	0.355 ± 0.010	5.57 ± 0.31
OVX+F	9.08 ± 0.20	0.141 ± 0.030*	0.367 ± 0.013	5.58 ± 0.29
OVX+M	9.36 ± 0.36	0.165 ± 0.015	0.358 ± 0.009	5.49 ± 0.27
FLL+FM	9.69 ± 0.27	0.099 ± 0.009**	0.385 ± 0.018	6.80 ± 0.34*

Values are expressed as means ± SEM, n = 6–8 in each group. # p < 0.05, compared with the Sham; * p < 0.05, ** p < 0.01, compared with the OVX. F, Fructus Ligustri Lucidi; M, milk powder fortified with calcium; FM, F combined with M.

While a combination therapy of high calcium diet with FLL could significantly decrease urine Ca²⁺ excretion (p < 0.01) and enhance bone calcium content (p < 0.05) as compared with those of the OVX group, as well as increase serum Ca²⁺ level (9.07 ± 0.42–9.69 ± 0.27 mg/dl) and the ratio of bone calcium to bone ash weight (0.355 ± 0.010–0.385 ± 0.018 mg/mg) in OVX mice, which were even higher than those in the Sham group (serum Ca²⁺, 9.35 ± 0.32 mg/dl; bone Ca/Ash, 0.371 ± 0.017 mg/mg). From these calcium balance data, it was clearly shown that the combined treatment of high-calcium diet with FLL-exerted synergistic effects on maintaining calcium balance of OVX mice.

As FLL displayed beneficial effects on suppressing high excretion of urine calcium in OVX mice, the regulation of FLL on mRNA expression of the proteins, which are involved in modulating renal calcium reabsorption, was studied. Figure 1 shows the expression patterns of calcium-sensing receptor (CaSR) and calcium-binding protein-9k (CaBP-9k) in kidney. The up-regulation of CaSR (p < 0.001) and the down-regulation of CaBP-9k (p < 0.01) in OVX mice were significant as compared with those in the Sham group. The decrease of CaBP-9k mRNA expression in kidney of OVX mice was effectively inhibited (p < 0.01) by FLL treatment alone. Similar results were found in duodenal CaBP-9k expression of aged female rats (Zhang et al., 2008) and growing rats (Feng et al., 2014; Lyu et al., 2014) upon to FLL treatment. In addition, the modulation of FLL on renal CaBP-9k expression contributed to the recovery of CaBP-9k expression level in the combination treatment group, as high-calcium diet alone did not produce any change of renal CaBP-9k expression in OVX mice (Figure 1B).

Figure 1. mRNA expression of CaBP-9k and CaSR in kidney (A) and the densitometric quantification (B). Values are expressed as means ± SEM, n = 6–8. ##p < 0.01, ###p < 0.001, compared with the Sham group; *p < 0.05, **p < 0.01, compared with the OVX group. F, Fructus Ligustri Lucidi; M, milk powder fortified with calcium; FM, F combined with M.

Interestingly, both FLL alone (p < 0.05) and high-calcium diet alone (p < 0.05) could markedly reduce the mRNA expression of CaSR in kidney of OVX mice, moreover, the expression of CaSR in the combined treatment group was almost recovered to the level of the Sham group (p < 0.01). The reduction in expression of renal CaSR in OVX mice in response to either FLL or high-calcium intake contributed to observed decrease of urinary calcium excretion, similarly the combination of FLL with high-calcium intake produced promising improvement on urinary calcium level of OVX mice which resulted from the synergetic effect on the regulation of renal CaSR shown in this study. The present study reported the regulation of FLL on CaSR, even though there is emerging evidence to demonstrate its regulation on calcium-transporting proteins (Feng et al., 2014; Lyu et al., 2014; Zhang et al., 2008). Thus, the present results provided us with a clue that the potential effects of FLL on CaSR in parathyroid gland need to be further explored to explain the observed increase of serum PTH level as described previously (Dong et al., 2012). In addition, the possibility of FLL as CaSR antagonist should also be studied to show its potential on directly regulating bone metabolism by the increasing PTH level.

Taken together, the present work suggested that FLL with high-calcium diet, like milk powder fortified with calcium, could effectively maintain calcium balance in vivo which might contribute to the prevention and treatment of osteoporosis. We revealed the regulation of FLL on renal CaSR expression. Future work needs to place emphasis on investigating the role of FLL in modulating CaSR in the parathyroid gland and exploring potential healthy outcomes as a CaSR antagonist.

Declaration of interest

The authors have no conflicts of interest to declare. This work was sponsored by the Open Project Program of State Key Laboratory of Dairy Biotechnology, Bright Dairy & Food Co. Ltd. (No. SKLDB2012-008), National Natural Science Foundation of China (No. 81202894), and China Postdoctoral Science Foundation funded project (2012M511115).