Modulatory actions of o-coumaric acid on carcinogen-activating cytochrome P450 isozymes and the potential for drug interactions in human hepatocarcinoma cells

Abstract

Context: Although humans are exposed to o-coumaric acid (OCA) in their diet, there is no available literature related to drug interaction and the carcinogen-activating potential of OCA in the HepG2 cell line.

Objective: This study was undertaken to determine the effects of OCA on the cytochrome P450 (CYP) 1A2, CYP2E1, CYP2C9, and CYP3A4 enzymes, which are primarily involved in carcinogen and drug metabolism.

Materials and methods: The cytotoxicity of OCA in HepG2 cells was investigated by measuring the cleavage of WST-1. The protein and mRNA levels of CYPs were determined by western blotting and RT-PCR, respectively.

Results: The EC10, EC25, and EC50 values of OCA were calculated to be 1.84, 3.91 and 7.39 mM, respectively. A sublethal dose of 5 mM was used throughout this study. The CYP1A2 protein and mRNA levels were increased by 52 and 40% (p < 0.05), as were the CYP2E1 levels by 225 and 424%, respectively (p < 0.05). However, OCA treatment caused 52 and 60% decreases in the levels of CYP3A4 protein and mRNA (p < 0.05), respectively. In contrast to CYP3A4, the CYP2C9 protein and mRNA levels increased by 110 and 130%, respectively.

Discussion and conclusion: Co-administration of OCA with some drugs may lead to undesirable food–drug interactions due to modulatory effects on CYP isozymes involved in drug metabolism. Moreover, exposure to OCA may cause an increase in carcinogenicity and toxicity due to the induction of the CYP isozymes involved in chemical carcinogenesis. Therefore, serious precautions should be taken when using OCA as a supplement.

• Carcinogen activation
• cytochrome P450 (CYP)
• HepG2 cells

Introduction

In recent years, the use of herbal preparations and phytochemicals isolated from herbs as complementary and alternative therapies has grown considerably in the Western world. Many herbs and herbal phytochemicals are natural and are thus considered to be safe. In addition, their usage has increased in diseases such as cancer, for which conventional methods have often failed to provide satisfactory solutions. However, there are problems regarding the use of such preparations, mainly the lack of critical information regarding the toxicity, allergenicity, mutagenicity, and possible drug interactions of the compounds.

A number of herbs and phytochemicals, including Ginkgo biloba L. (Ginkgoaceae) (Rowin & Lewis, 1996), Allium sativum L. (Amaryllidaceae) (Piscitelli et al., 2002), Hypericum perforatum L. (Hypericaceae) (Markowitz et al., 2000), Urtica urens L. (Urticaceae) (Agus et al., 2009; Ozkarsli et al., 2008), resveratrol (Detampel et al., 2012), curcumin (Cho et al., 2012), and silibinin (Li et al., 2010), have been reported to interact pharmacokinetically with drugs by altering both the expression and activities of drug-metabolizing enzymes, particularly cytochrome P450s (CYPs). Thus, in vitro and in vivo studies clarifying pharmacokinetic interactions, altered drug concentrations, and enhanced bioactivation of drugs to reactive intermediates, which may be attributable to the induction and/or inhibition of CYPs by co-administered herbs, have important clinical significance (Zhou et al., 2003).

The cytochrome P450 superfamily comprises hemoproteins that play key roles in the bioactivation and detoxification of a wide range of xenobiotic substances. Moreover, these enzymes also play important roles in the metabolism and synthesis of endogenous compounds. Multiple CYP isozymes show different substrate specificities and affinities toward both endogenous and exogenous compounds. Indeed, the CYP1A, CYP2E, CYP2C, and CYP3A subfamilies have received a great deal of attention in recent years because of their capacity to metabolize various pharmaceutical agents and their role in carcinogenicity (Arinç et al., 2005; Chung et al., 2004; Sen & Arinc, 1998; Sen et al., 2012). Among CYPs, the CYP1A and CYP2E enzymes are primarily involved in carcinogen metabolism, whereas the CYP3A, CYP2D, and CYP2C enzymes typically participate in drug metabolism. Therefore, it is not surprising to observe drug toxicity or carcinogen activation with herbal extracts and herb-based compounds used as complementary therapeutics, as they can be moderate-to-potent inhibitors or inducers of these CYPs.

Recently, more than 5000 different phytochemicals have been identified in fruits, vegetables, and other plants parts, but a large percentage remain unknown (Huang et al., 2010). One of the major families of phytochemicals in plants are phenolic compounds, representing a diverse group of compounds, including phenolic acids, flavonoids, tannins, stilbenes, curcuminoids, coumarins, lignans, and quinones (Dai & Mumper, 2010; Landete, 2012). Among these compounds, phenolic acids have the simplest structure; they are non-flavonoid polyphenolic compounds that are widely present in many fruits, vegetables, cereals and medicinal herbs (De et al., 2011; Plazonic et al., 2009; Robbins, 2003). Therefore, the dietary intake of these phenolic acids is quite high, ranging from 25 mg to 1 g/d depending on the diet (Clifford, 1999; Radtke et al., 1998; Scalbert & Williamson, 2000).

Phenolic acids can be divided into two main groups based on their C1–C6 and C3–C6 backbones: hydroxybenzoic acid (e.g., gallic, vanillic, and syringic acids) and hydroxycinnamic acid (ferulic, caffeic, and p-coumaric acid) (Robbins, 2003). o-Coumaric acid is a hydroxycinnamic acid found in many food and plant products, such as coffee, tea, nuts, Mikania laevigata Sch.Bip. ex Baker (Compositae), Mikania glomerata Spreng, Medicago sativa L. (Leguminosae), Caucalis platycarpos L. (Apiaceae), and Urtica urens (Abu Bakar et al., 2012; Chon & Kim, 2002; Dos Santos et al., 2006; Perrone et al., 2008; Plazonic et al., 2009). Studies have shown that o-coumaric acid (OCA) (Figure 1) has different biological activities, such as antilipidemic, antioxidant, and anticarcinogenic activities (Hsu et al., 2009; Yeh et al., 2005). Moreover, the effect of OCA treatment on the mRNA levels of CYP isozymes in a human breast cancer cell line (MCF7) was examined recently in our laboratory (Sen et al., 2013). Regardless, the liver is the main organ for the metabolism of xenobiotics; drug interactions and the carcinogen-activating potential of OCA for this organ are not known. Therefore, in this study, the effect of OCA on drug-metabolizing CYP enzymes at the mRNA and protein expression levels was investigated in a human hepatocarcinoma cell line (HepG2 cells).

Figure 1. Structure of o-coumaric acid.

Materials and methods

Chemicals

The following chemicals and reagents were purchased from Sigma-Aldrich Chemical Company (St Louis, MO): o-coumaric acid (OCA), Dulbecco's Modified Eagle Medium (DMEM), fetal bovine serum (FBS), trypsin, penicillin/streptomycin mixture, aniline, bovine serum albumin (BSA), bicinchoninic acid (BCA), glycine, N-2-hydroxyethylpiperazine-N′-2, ethanesulfonic acid (HEPES), phenylmethylsulfonyl fluoride (PMSF), ɛ-aminocaproic acid (ɛ-ACA), sodium dodecyl sulfate (SDS), and 2-amino-2-(hydroxymethyl)-1,3-propanediol (TRIS). WST-1 cell proliferation and cytotoxicity assay kits were purchased from Boster Biological Technology (Pleasanton, CA).

A polyclonal anti-human CYP2E1 antibody was obtained from Oxford Biomedical Research (Rochester Hills, MI), and polyclonal anti-human CYP1A2 and CYP3A4 antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-human CYP2C9 was obtained from Abcam PLC (Cambridge, UK). All other chemicals and solvents were obtained from commercial sources at the highest grade of purity available.

Cell culture

A human hepatocellular liver carcinoma cell line (HepG2) was obtained from the European Collection of Cell Cultures (ECACC, UK). The cells were cultured in DMEM supplemented with 10% FBS and a 1% penicillin/streptomycin mixture in a humidified atmosphere of 95% air with 5% CO₂ at 37 °C and were subcultured twice a week.

Cytotoxicity assay

HepG2 cells were grown in 96-well plates at a density of 1 × 10³ cells/ml culture medium. After a 24 h pre-exposure incubation, the cells were treated with a range of concentrations of OCA between 1 and 10 mM. OCA was dissolved in dimethyl sulfoxide (DMSO), and the final concentration of DMSO did not exceed 0.1%. Control cultures were also treated with 0.1% DMSO. An equal volume of medium without OCA was added to untreated cells (control). The OCA-treated and control cells were incubated for 48 h at 37 °C in a humidified 5% CO₂ atmosphere. After 48 h, cell proliferation was assessed using 10% WST-l (4-(3-(4-iodophenyl)-2-(4-nitrophenyl)-2H-5-tetrazolio)-1,3-benzene disulfonate). Briefly, 10 µl WST-l was added to the wells and incubated for 1 h, and then, cell proliferation was assessed by measuring the absorbance at 450 nm. Three replicated wells were used for each experimental condition. Viability was expressed as a percentage of the control.

Cell homogenate preparation

HepG2 cells (1 × 10⁷ cells per 75 cm² flask) were exposed to 5 mM OCA and harvested after a 24 h treatment. The cells were then washed twice with PBS, scraped from culture dishes into lysis buffer (0.1 M phosphate buffer Tris-HCl, pH 7.8, 0.2% Triton X-100, 2 mM EDTA, 0.5 mM PMFS, 0.3 mM ɛ-ACA, and 1 mM 1,4-dithiothreitol (DTT)) and homogenized mechanically by sonication. The total cellular protein concentration was determined using the BCA assay with BSA as the standard.

Gel electrophoresis and western blotting

SDS-PAGE and western blotting were performed as previously described (Sen & Arinc, 1998). HepG2 total protein was extracted with the TRIzol reagent (Invitrogen, Waltham, MA) as described (Lee et al., 2001). Protein samples (150 μg) were separated on 8.5 or 12% polyacrylamide gels using a discontinuous buffer system (Laemmli, 1970) and transferred to nitrocellulose membranes using the iBlot (Invitrogen, Waltham, MA) dry blotting system (20 V, 12 min) by employing iBlot gel-transfer stacks. Following transfer, the membranes were blocked with 5% non-fat dry milk in TBS-T [20 mM Tris-HCl, pH 7.4, 400 mM NaCl, and 0.1% (v/v) Tween-20] for 60 min and incubated with polyclonal anti-human CYP2E1, CYP1A2, CYP2C9, or CYP3A4 antibody (diluted 1:200–1:500 in blocking solution) overnight at room temperature. The membranes were then washed with TBS-T (3 × 5 min), incubated with the secondary antibody (HRP-conjugated secondary antibody at a 1:5000 or 1:10 000 dilution) for 60 min and again washed with TBST (3 × 5 min). The proteins were detected using SuperSignal® West Pico chemiluminescent substrate (Pierce, Rockford, IL). The final images were photographed using a computer-based gel imaging DNR LightBIS Pro Image Analysis System (Invitrogen, San Diego, CA), and the protein bands were quantified using Scion Image Version Beta 4.0.2 software (National Institutes of Health, Bethesda, MD).

RNA isolation and RT-PCR of CYP mRNAs

Total RNA was extracted from HepG2 cells using the TRIzol reagent. The extracted RNA was quantified spectrophotometrically at 260/280 nm, and the integrity was checked using a 1% agarose gel. For cDNA synthesis, 2.5 µg of RNA was incubated at 70 °C for 10 min with 0.5 µg of oligo (dT). After 5 min on ice, 50 U of Moloney murine leukemia virus reverse transcriptase, 1 mM dNTPs, and 5X reaction buffer were added to the previous mixture and incubated at 42 °C for 60 min. The reaction was stopped by heating at 70 °C for 10 min, and the cDNA was stored at −80 °C for further use.

A semi-quantitative two-step RT-PCR assay was performed using gene-specific primers. The oligonucleotide sequences used as forward and reverse primers for human CYP isozymes were based on those reported in the literature (Maruyama et al., 2007; Wilkening et al., 2003), and the 18S rRNA gene was used as a control housekeeping gene. Preliminary control experiments (data not shown) were carried out to verify the RT-PCR conditions that allowed for linear amplification. The PCR products were analyzed by electrophoresis on 1.5–2% agarose gels containing ethidium bromide, and the intensity of the bands was measured using Scion Image Version Beta 4.0.2 software (National Institutes of Health, Bethesda, MD). The mRNA levels of the CYP genes were determined by measuring the intensity of the RT-PCR product bands on each agarose gel and are reported relative to 18S rRNA expression (Table 1).

Table 1. Oligonucleotide primers sequences and amplification conditions.

Gene	Primer sequence (5′ → 3′)	Annealing temperature (°C)	Product size (bp)
hCYP1A2F	ACT TCG ACC CTT ACA ATC AG	53.3	285
hCYP1A2R	CAC TGT TCT TGT CAA AGT CC
hCYP2E1F	ATGGACCTACCTGGAAGGACAT			61	690
hCYP2E1R	GCATCT CTT GCC TAT CCT T
hCYP3A4F	GCC TGG TGC TCC TCT ATC TA	54.7	187
hCYP3A4R	GGC TGT TGA CCA TCA TAA AAG
hCYP2C9F	CTG GAT GAA GGT GGC AAT TT			59	308
hCYP2C9R	AGA TGG ATA ATG CCC CAG AG
h18SF	CGG CTA CCA CAT CCA AGG AA	58.4	187
h18SR	GCT GGA ATT ACC GCG GCT

Statistical analysis

Statistical analyses were performed using the Minitab statistical software package (Minitab Inc., State College, PA). All results are expressed as the means including the standard error of means (SEM). A comparison between groups was performed using Student’s t test, and p < 0.05 was selected as the level required for statistical significance.

Results

The cytotoxicity of OCA in HepG2 cells was investigated by measuring the cleavage of WST-1 to formazan by metabolically active cells. As shown in Figure 2, OCA treatment showed a dose-dependent cytotoxic effect on HepG2 cells. The viability of the treated HepG2 cells was reduced by 11.1 and 31.3% after incubation with 2.5 and 5 mM OCA, respectively, compared with the untreated control cells. The EC10, EC25, and EC50 values of OCA were found to be 1.84, 3.91, and 7.39 mM, respectively. A sublethal dose of 5 mM was used throughout this study.

Figure 2. Cytotoxicity of o-coumaric acid (OCA) on HepG2 cells after 48 h. The results are expressed as the means of two independent experiments, with each experiment performed in triplicate. *Significantly different from the respective control value (p < 0.05).

The effect of OCA on the expression of the main CYP isozymes participating in both drug and carcinogen metabolism was determined in this study (Figures 3–6). Densitometric scanning of western blots revealed that the CYP1A2 protein level was increased by 52% in OCA-treated cells relative to untreated cells (Figure 3). Similarly, the level of CYP1A2 mRNA was increased by 40% following 5 mM OCA treatment (p < 0.05). In addition, CYP2E1 protein levels were also found to be increased by 225% following OCA treatment (Figure 4). As presented in Figure 4, the mRNA level of CYP2E1 was increased by 424% in OCA-treated cells. In contrast to CYP2E1 and CYP1A2, the CYP3A4 protein level decreased by 52% in the OCA-treated cells relative to the untreated control cells (Figure 5, p < 0.05). Correspondingly, the level of CYP3A4 mRNA was significantly decreased by 60% in the OCA-treated cells (Figure 5). In contrast, with respect to untreated cells, CYP2C9 protein and mRNA levels were increased following OCA treatment (Figure 6), causing a 110% increase in the protein level (p < 0.05) and a 130% increase in the mRNA level.

Figure 3. Effects of o-coumaric acid (OCA) on CYP1A2 protein and mRNA levels in HepG2 cells. Representative images for (a) immunoblot and (b) RT-PCR (agarose gel) results showing CYP1A2 protein and mRNA expression, respectively. (c) Comparison of CYP1A2 protein and mRNA levels among experimental groups. The bar graphs represent the relative intensity of the bands obtained from western blotting and RT-PCR. The experiments were repeated at least three times. *Significantly different from the respective control value (p < 0.05).

Figure 4. Effects of o-coumaric acid (OCA) on CYP2E1 protein and mRNA levels in HepG2 cells. Representative images for (a) immunoblots and (b) RT-PCR (agarose gel) results showing CYP2E1 protein and mRNA expression, respectively. (c) Comparison of CYP2E1 protein and mRNA levels among experimental groups. The bar graphs show the relative intensity of the bands obtained from western blotting and RT-PCR. The experiments were repeated at least three times. *Significantly different from the respective control value (p < 0.05).

Figure 5. Effects of o-coumaric acid (OCA) on CYP3A4 protein and mRNA levels in HepG2 cells. Representative images for (a) immunoblots and (b) RT-PCR (agarose gel) results showing CYP3A4 protein and mRNA expression, respectively. (c) Comparison of CYP3A4 protein and mRNA levels among experimental groups. The bar graphs represent the relative intensity of the bands obtained from western blotting and RT-PCR. The experiments were repeated at least three times. *Significantly different from the respective control value (p < 0.05).

Figure 6. Effects of o-coumaric acid (OCA) on CYP2C9 protein and mRNA levels in HepG2 cells. Representative images for (a) immunoblots and (b) RT-PCR (agarose gel) results showing CYP3A4 protein and mRNA expression, respectively. (c) Comparison of CYP2C9 protein and mRNA levels among experimental groups. The bar graphs show the relative intensity of the bands obtained from western blotting and RT-PCR. The experiments were repeated at least three times. *Significantly different from the respective control value (p < 0.05).

Discussion

Increasing interest in herbal remedies is being observed in Western countries. However, toxicity to the heart, liver, blood, kidneys, central nervous system, and skin and carcinogenesis due to adverse drug reactions and poisoning associated with the use of herbal medicines have also raised (Deng, 2002; Klesper & Klepser, 1999). The most important factor in the development of these undesired effects of several herbs is the induction and inhibition of CYP-dependent drug-metabolizing enzymes (Zhou et al., 2003). This is the first study to reveal the effects of OCA on xenobiotic metabolism and possible drug interactions and carcinogen-activating potential in a human cancer cell line. Moreover, the cytotoxic effect of OCA was determined for the first time in a human hepatocarcinoma (HepG2) cell line.

Human liver-derived cell lines can be ideal models for routine toxicological experiments because of their availability, unlimited life-span, stable phenotype and easy handling. Indeed, HepG2 cells were developed with the intention that they would replace fresh human hepatocytes in preliminary toxicology and drug screening. These cells have an obvious advantage with regard to their availability and experimental reproducibility. Moreover, HepG2 cells display genotypic and phenotypic characteristics that are similar to human hepatocytes (Sassa et al., 1987). This cell line also expresses certain drug-metabolizing enzymes, including CYPs (Choi et al., 2004; Hewitt & Hewitt, 2004). For these reasons, the HepG2 cell line was used throughout this study.

The cytotoxicity of OCA in human cancer was investigated using WST-1 assays. As shown in Figure 2, OCA treatment caused a concentration-dependent cytotoxic effect in HepG2 cells. Moreover, OCA is able to exert a cytotoxic effect by stimulating multiple processes, including apoptosis, cell cycle regulation and tumor suppression (Sen et al., 2013). The profile of human exposure to phenolic acids remains complex, and the estimated daily intake of phenolic acids varies between 25 mg and 1 g/d depending on the diet (Clifford, 1999; Scalbert & Williamson, 2000; Radtke et al., 1998). The OCA concentration used in HepG2 cells in this study, 5 mM (821 µg/ml), was in the range of the human dietary intake value.

OCA treatment of 5 mM in HepG2 cells significantly increased CYP1A2 protein and mRNA levels (Figure 3). CYP1A2 mRNA levels were reported to increase by 175% in OCA-treated cells relative to untreated control MCF7 cells (Sen et al., 2013). In contrast to OCA, ferulic acid and p-coumaric acid treatment decreased CYP1A1 enzyme activity in a human colon adenocarcinoma cell line (Ferguson et al., 2005). Conversely, various herbal extracts and phenolics, such as Cyclamen trochopteranthum O. Schwarz (Primulaceae), Salvia miltiorrhiza Burke (Lamiaceae), tanshinone, protocatechuic and tannic acids, caused increase in CYP1A2-related enzyme activity and protein levels (Arslan et al., 2011; Kuo et al., 2006; Lee et al., 2012; Szaefer et al., 2003). Among all the cytochrome CYP isoforms, CYP1A is considered to be the most critical for such studies due to its role in the metabolism of carcinogens, mutagens, and environmental pollutants. The results of the present study collectively suggest that the induction of CYP1A2 by OCA may stimulate the metabolic breakdown of many carcinogenic and pro-carcinogenic substrates, such as benzo(a)pyrene and aromatic and heterocyclic amines. It has been shown that when CYP1A2 is induced by cigarette smoke, carcinogenicity or hepatotoxicity due to heterocyclic amines is increased (Koide et al., 1999; Nishikawa et al., 2002). Therefore, the activation of this metabolic pathway due to OCA exposure may lead to increased organ toxicity, mutagenesis, and carcinogenesis in people.

A densitometric analysis of western blot results and RT-PCR showed that CYP2E1 protein and mRNA levels were significantly increased in OCA-treated cells relative to the control cells (Figure 4). However, the regulation of CYP2E1 expression is complex, involving transcriptional, post-transcriptional, and post-translational events (Song, 1995), and it remains to be elucidated whether the increase in CYP2E1 protein and mRNA resulting from OCA treatment are transcriptional or post-transcriptional. Similar to the results obtained in this study, some other herbs or chemical compounds isolated from herbs induced not only CYP2E1 catalytic activity but also its protein level (Bray et al., 2002; Pass et al., 1999).

CYP2E1 has received more attention in recent years because of its vital role in the activation of many low-molecular-weight toxic chemicals, such as benzene, carbon tetrachloride, nitrosamines, thioacetamide, and pyridine (Arinç et al., 2000, 2007; Guengerich et al., 1991; Krishnan & Brodeur, 1991; Wang et al., 2000; Yang & Hong, 1995). An increase in toxicity was demonstrated when CYP2E1 inducers were administered 12–24 h prior to exposure to a toxic or carcinogenic chemical (Krishnan & Brodeur, 1991; Lorr et al., 1984; Yang & Hong, 1995). The results of the present study suggest that OCA can stimulate the metabolic activation of N-nitrosodimethylamine, pyridine, benzene, and other toxic chemicals that are metabolized by CYP2E1 by increasing its expression. This may, in turn, result in increased amounts of reactive metabolites, which may further potentiate the risk of organ toxicity, mutagenesis, and malignant transformation in individuals who use OCA as an herbal remedy for liver disease.

The effects of OCA on the protein and mRNA levels of CYP3A4 and CYP2C9 were also determined. The CYP3A4 mRNA and protein levels were decreased (Figure 5), similar to the reported 75% decrease in the mRNA level in response to OCA treatment in MCF7 cells (Sen et al., 2013). The CYP2C9 protein and mRNA levels were increased in HepG2 cells after 24 h of OCA treatment (Figure 6), whereas the mRNA level was significantly decreased in MCF7 cells (Sen et al., 2013). Tissue- or species-specific modifications have also been observed for CYP isozymes due to chemicals and pathophysiological situations, such as diabetes (Koide et al., 1999; Nishikawa et al., 2002; Song, 1995). Indeed, the results of the present work indicate different tissue-specific responses to OCA in HepG2 and MCF7 cell lines. The pregnane X receptor (PXR) and constitutive androstane receptor (CAR) serve as key regulators of CYP3A gene expression (Hiroi et al., 1998; Waxman, 1999; Willson & Kliewer, 2002), and the present data indicated that OCA may affect both, resulting in the inhibition or induction of CAR and PXR transcriptional activity, and thus changes in CYP3A4 and CYP2C9 expression. However, further, more detailed analyses must be performed to confirm this inference.

The CYP3A subfamily is thought to have the greatest overall impact on human pharmacotherapy because it comprises the most abundantly expressed CYPs in the human liver and small intestine and its members possess metabolic activity toward an extremely broad spectrum of xenobiotic substrates, including antibiotics, sedatives, immune system modulators, calcium channel blockers, HIV-directed antiviral agents, and HMG CoA reductase inhibitors (de Wildt et al., 2007; Sugimoto et al., 2006). The next most important group is the CYP2C subfamily, which accounts for approximately 20% of the entire liver cytochrome P450 content in humans. This family is responsible for the metabolism of approximately 20% of all clinically administered drugs, including anti-coagulants, anti-diabetic agents, non-steroidal anti-inflammatory drugs, and anticonvulsants (Carlile et al., 1999). It is well established that the modulation of these cytochrome P450 isozymes by plant extracts, chemicals, or pathophysiological situations results in impaired drug metabolism. For example, the administration of Sophora flavescens Aiton (Leguminosae) extract to rats altered the pharmacokinetic profile of theophylline by modulating CYP isozymes (Ueng et al., 2010). Therefore, on the basis of its nondiscriminatory effects on a number of significant drug-metabolizing enzymes, OCA could in theory influence the actions of many medicines. Moreover, the alteration of drug clearance and clinical drug toxicity may be observed due to changes in these CYP isozymes.

Conclusions

In conclusion, based on the observed alterations in CYP3A4 and CYP2C9 protein and mRNA levels, OCA would be expected to modify the metabolism of other essential medications, including antibiotics, antiarrhythmics, immune modulators, steroids, and antiepileptics. On the basis of its nondiscriminatory effects on a number of important drug-metabolizing enzymes, OCA could, in theory, affect the actions of many medicines and may result in food–drug interactions. Therefore, until further clinical drug interaction experiments are completed, the co-administration of drugs with OCA should be avoided. Moreover, the results of the present study suggest that OCA stimulates the metabolic activation of toxic chemicals metabolized by not only CYP2E1 but also CYP1A2 by inducing these enzymes, which results in increased formation of reactive metabolites. This may, in turn, further potentiate the risk of toxicity and carcinogenesis. Therefore, serious precautions should be taken in terms of extensive OCA exposure through diet or supplementation.

Declaration of interest

This study was supported by a grant from The Scientific and Technological Research Council of Turkey (111T011).

Notes

* The preliminary results reported herein were presented at the 19th International Symposium on Microsomes and Drug Oxidations, 12th European Regional ISSX Meeting in Noordwijkaan Zee, The Netherlands, 17–21 June 2012.