Characterization of stress and methylglyoxal inducible triose phosphate isomerase (OscTPI) from rice

Abstract

As compared with plant system, triose phosphate isomerase (TPI), a crucial enzyme of glycolysis, has been well studied in animals. In order to characterize TPI in plants, a full-length cDNA encoding OscTPI was cloned from rice and expressed in E. coli. The recombinant OscTPI was purified to homogeneity and it showed K_m value of 0.1281 ± 0.025 µM, and the Vmax value of 138.7 ± 16 µmol min⁻¹mg⁻¹ which is comparable to the kinetic values studied in other plants. The OscTPI was found to be exclusively present in the cytoplasm when checked with the various methods. Functional assay showed that OscTPI could complement a TPI mutation in yeast. Real time PCR analysis revealed that OscTPI transcript level was regulated in response to various abiotic stresses. Interestingly, it was highly induced under different concentration of methylglyoxal (MG) stress in a concentration dependent manner. There was also a corresponding increase in the protein and the enzyme activity of OscTPI both in shoot and root tissues under MG stress. Our result shows that increases in MG leads to the increase in TPI which results in decrease of DHAP and consequently decrease in the level of toxic MG.

Keywords: :

• OscTPI
• abiotic stress
• glyoxalase pathway
• methylglyoxal
• triose phosphate isomerase

Introduction

Methylglyoxal (MG), a cytotoxin, is a typical 2-oxoaldehyde byproduct of several metabolic pathways such as threonine catabolism and lipid peroxidation. However, the major source of production of MG is via glycolysis where it is produced from non-enzymatic elimination of phosphate from glyceraldehyde-3-phosphate (GAP) and dihydroxyacetone phosphate DHAP. The interconversion of DHAP and GAP is catalyzed by a crucial glycolytic enzyme, triose phosphate isomerase (TPI) which plays an important role in other metabolic pathways involving triosephosphate, such as gluconeogenesis, fatty acid biosynthesis, pentosephosphate pathway, and photosynthetic carbon dioxide fixation.¹ High resolution crystal structures are available for TPI from chicken,² yeast,³ and Trypanosoma brucei.⁴ The extremely high turnover rate of TPI has led to its description as a nearly perfect catalyst.⁵ Genes encoding TPI have been cloned and sequenced from 11 species, including chicken,⁶ human^7,8 maize,⁹ mouse,¹⁰ Aspergillus nidulans,¹¹ Coptis japonica,¹² Escherichia coli,¹³ Macaca mulatta,¹⁴ T. brucei,¹⁵ Saccharomyces cerevisiae,¹⁶ and Schizosaccharomyces pombe.¹⁷ The high degree of sequence conservation of TPI suggests a low rate of evolutionary divergence, a common feature of all the glycolytic enzymes.¹⁸ Isolation and characterization of a cDNA clone encoding the cytosolic form of TPI from rice has also been reported.¹⁹

It has been reported that loss of TPI activity results in elevated levels of DHAP^20,21 which in turn, is spontaneously converted to MG that modifies proteins and DNA through the formation of Advanced Glycation End products (AGEs) are deleterious to cells.²² Enhanced AGE production also leads to many disease symptoms in humans.²³ However, under conditions of oxidative stress, glutathione levels are reduced, resulting in elevated levels of MG which, in turn, lead to progressive neurological dysfunction, neurodegeneration, and early death. This effect can be further magnified in a positive feedback loop because AGEs themselves contribute to the production of reactive oxygen species.²⁴

Although MG is synthesized during normal metabolism of glucose, it inhibits the growth of cells of microorganisms as well as higher eukaryotes, eventually killing them. Therefore, studies on the metabolic effect of MG are of considerable interest. It has been earlier reported that MG is metabolized to lactic acid by two different routes.²⁵ One is the glyoxalase system in which glyoxalase I and glyoxalase II are involved. In this route, MG is condensed with glutathione to give S-D-lactoylglutathione by the action of glyoxalase I, and the glutathione thiolester is then hydrolyzed to lactic acid and glutathione by glyoxalase II.²³ Glyoxalase pathway in plants have also been reported as a major detoxification pathway in plants.²⁶ The other route is a reduction/oxidation system consisting of methylglyoxal reductase and lactaldehyde dehydrogenase. MG is reduced to lactaldehyde by NADPH dependent methylglyoxal reductase, and lactaldehyde is further oxidized to lactic acid by NAD+-dependent lactaldehyde dehydrogenase.²⁷

There is an abundance of literature on the role, structure and regulation of animal TPIs. However, the current research on plant TPI is limited. Molecular weight of TPI has been depicted in rabbit,²⁸ yeast,¹⁶ and bacteria²⁹ which is found to be 247 to 255 amino acids long polypeptide chains of approximate molecular weight of 27,000 Daltons. In vascular plants, only a limited number of studies have been undertaken to show the function of TPI where it was first purified from pea seeds.³⁰ The existence of plastid and cytosolic TPI isozymes was first reported in an extensive survey of isoelectric points of the enzyme in numerous species of angiosperms, gymnosperms, ferns, and fern allies.³¹ TPI isozyme has also been purified from spinach, lettuce, and celery.¹³

In the present study, we report that rice cytoplasmic TPI is induced in response to MG stress.MG affects the transcript, protein and enzyme activity. This could be a mechanism to bring down the toxic levels of MG under stress conditions defending the plants against abiotic stress.

Results

Identification and chromosomal distribution of TPI genes in rice

We have identified 3 TPI genes within the rice genome (TIGR, version 6.1), encoding three isoforms of TPI proteins. They have been demarcated on the basis of cellular localization of the encoded proteins. The physical distribution of TPI genes on different chromosomes of rice is shown in Figure 1A. Out of three isoforms, two are located on chromosome no I, while the third is situated on chromosome IX. The genes on chromosome I encode cytosolic proteins and show about 70% homology at amino acid level with each other (Fig. 1B). The gene located on chromosome IX encodes proteins localized in chloroplast. A chloroplastic isoform of triose phosphate isomerase (pdTPI) has been recently found important in the postgerminative seedling establishment and it also plays a crucial role in the transition from heterotrophic to autotrophic growth to provide energy and carbon in Arabidopsis.³²

Figure 1. Chromosomal distribution events for TPI genes. (A) Three genes for TPI located on chromosome I and IX in rice. The scale is in megabase (Mb), and the centromeric regions are indicated by ellipses. (B) Multiple alignment of TPI genes in rice where first two sequences show the cytosolic TPI and the last one represents the chloroplastic TPI. ClustalW2 program was used to generate the alignment. (C) Unrooted tree generated for cTPI from different organisms using neighbor joining method employing Mega4 software. (D) Expression profile of TPI genes from Affymetrix GeneChip Rice Genome Arrays (http://www.ncbi.nlm.nih.gov/geo). The heatmaps have been generated using TIGR MeV software package. The color bar represents relative expression values; thereby, green color represents lowest expression levels, black represents medium expression levels, and red signifies highest expression level

Phylogenetic tree reveals that there is about 60–80% similarity between the TPI sequences of Arabidopsis thaliana, Solanum tuberosum, Hordeum vulgare, Zea mays and Oryza sativa (Fig. 1C).

The cytoplasmic TPI, present on the chromosome no I (LOC_Os01g62420) was selected for further studies, which showed four splice forms (http://rice.plantbiology.msu.edu/). The CDS coordinates (5′-3′) is from 36129310 – 36132720. The predicted nucleotide and amino acid length is 768 bp and 255 aa respectively, whereas the molecular weight is 27273.4 D.

For microarray analysis of rice TPI genes, Affymetrix GeneChip Rice Genome Arrays (http://www.ncbi.nlm.nih.gov/geo/) was used. Spatial and temporal gene expression in various tissues/organs and developmental stages of rice was analyzed to identify the genes differentially expressed during various stages of reproductive development. OscTPI (LOC_Os01 g62420) was interestingly expressed at all the stages of development as compared with the other isoforms (Fig. 1D)

Expression, purification and specific activity of recombinant OscTPI

Clone of rice TPI located on chromosome no I was amplified and further cloned into pET28a bacterial expression vector. The pET28aOscTPI recombinant plasmid was transformed into BL21 (DE3) a specific host strain of E. coli, for expression of the recombinant protein. A highly induced band of 27 kDa was visible on SDS-PAGE, which was not present in the uninduced cells as well as induced negative control (BL21 cells containing empty vector (Fig. 2A). The recombinant protein was purified by anion exchange chromatography and monitored on SDS-PAGE (Fig. 2B). The eluted purified protein fractions were pooled and dialyzed against 20 mM Hepes buffer pH 8.0. Yield of the eluted soluble protein was about 7.0 mg/ml of culture.

Figure 2. Expression, purification and Kinetic parameters for OscTPI. (A) Heterologous expression of OscTPI recombinant protein in bacterial expression host E. coli BL21 (DE3) cells: Coomassie stained PAGE showing crude protein extract from untransformed (empty vector), uninduced and OscTPI transformed BL21 (DE3) cells induced at 37°C with 0.1 mM of IPTG. (B) Purification of recombinant OscTPI. Coomassie stained PAGE showing Ni-NTA affinity purified recombinant OsTPI uninduced and purified protein (1–3 Elution fractions in 250 mM imidazole). (C) Determination of kinetic parameters of OscTPI: Extrapolation of Km and Vmax values were done using Lineweaver-burk plot

Enzyme kinetics of OscTPI

Different kinetic parameters such as K_m and Vmax were determined with purified recombinant OscTPI by systematically varying the concentration of glyceraldehyde 3 phosphate (50 µM to 1 mM) in the presence of NADH. The K_m was found to be 0.1281 µM, and the Vmax 138.7 µmol min⁻¹mg⁻¹ (Fig. 2C). The kinetic values were very similar to other TPIs of many organisms such as Potato, Yeast, Rabbit and Chicken muscle.³³ (Table 1)

Table 1. Primer sequences used for cloning and Real Time PCR

Primer Name	Primer sequence (5′-3′)
OscTPI-UTR-Fwd	5′- CAGCTTCCACTCCACGAAAACC -3′
OscTPI-UTR-Rev	5′- GAACACTAAGCAGAAGACTTGACGG -3′
OscTPI-BamH1-Fwd	5′CGCGGATCCATGGCTGCCAGGAAGTTCT 3′
OscTPI-Xho1-Re	5′ CCGCTCGAGCTAAGCAGAAGACTTGACG 3′
OscTPI_Real_Fwd	5′ATCAGATGAACTGAAAGTGCCGTT3′
OscTPI_Real_Rev	5′GACTACGAAAACAAGTAATCAT3′
OscTPI_Xba_Fwd	5′GCTCTAGACAGCTTCCACTCCACGAAAACC3′
OscTPI_BamH1_Rev	5′AGTGGATCCTCAGCAGAAGACTTGACGGTAGCAGA3′
OscTPI_HindIII_Fwd	5′CCCAAGCTTCTAAGCAGAAGACTTGACG3′
OscTPI_BamH1_Rev	5′AGTGGATCCTCAGCAGAAGACTTGACGGTAGCAGA3′

Functional complementation of yeast TPI (TIM1) mutant with OscTPI

To confirm whether the OscTPI can functionally complement the yeast TIM1 (YDR050C) mutant by reverting the sensitive phenotype, OscTPI was cloned in yeast expression vector pYES2 under pGAL1 promoter which is galactose inducible and glucose repressible. S. cerevisiae strain BY4741 and TPI deletion strain in the BY4741 background were transformed with pYES2OscTPI construct or empty vector (pYES2 plasmid). Since pYES2 vector has Ura⁺ as the selection marker, the transformed yeast cells were grown on Ura^- SD media containing either glucose or galactose at 37°C while TIM mutant with empty vector was unable to grow at 37°C, the BY4741 WT yeast strain could grow. However, when the TIM mutant was transformed with pYES2OscTPIconstruct, it was able to complement the growth defect of TIM1 mutant at 37°C (in galactose containing media). This result clearly indicates that the rice OscTPI can functionally complement TIM mutation in yeast (Fig. 3).

Figure 3. Comparison of growth pattern of S. cerevisiae TIM1 mutant expressed under different temperature. S. cerevisiae transformed with pYES2 and PYES2 OscTPI on solid SD media with either 20% glucose (upper panel) or 20% galactose (lower panel). Plates were incubated at 30°C and 37°C for 72 h

Localization of TPI

To verify the cellular location, OscTPI cDNA was cloned into a GFP based vector, pMBPII-GFP. In the resulting plasmid pMBGFP-TPI, the expression of gene is governed by the strong constitutive cauliflower mosaic virus 35S promoter (CaMV 35S) and the nopaline synthase terminator (NOS-T). Upon inspection of Nicotiana tabacum protoplast transiently transfected with this plasmid, the protein was localized in the cytosol, and evenly distributed without forming any visible aggregates (Fig. 4A). The fluorescence was not detected in the untransfected control cells, confirming that the green fluorescence indeed originated from the expression of the introduced pMBGFP-OscTPI.

Figure 4. Localization of OscTPI. (A) The expression of OscTPI –GFP fused protein in tobacco mesophyll protoplast. Tobacco protoplsts were transiently transformed by PEG transfection using TPI-pMB construct (B) Onion peel epidermal cells showing expression of the OscTPI - green fluorescent (GFP) fusion protein driven by the 35S promoter, showing its distribution throughout the cytoplasm. (C) Cellular fractionation and Western Blot Hybridization

Localization assay for OscTPI was also performed using onion peel bombardment assay (Fig. 4B). The ORF of OscTPI was cloned into pMB-GFP vector and pMBGFP-OscTPI construct was used for onion peel transformation by particle bombardment using the PDS-1000 particle delivery system (Bio-Rad, USA). When observed under fluorescence microscope at 488 nm-exciting wavelengths, it was found to be equally distributed in the cytoplasm.

To further confirm the localization of TPI, cellular fractionation from 12 d old rice seedlings was performed by ultracentrifugation and various fractions such as cytosol, chloroplast and nuclei was collected. All the three fractions were loaded on SDS-PAGE and western blot hybridization was performed using the antibodies raised against TPI which reconfirmed the cytoplasmic nature of TPI.

Transcript analysis of OscTPI in response to various stresses

In order to understand the response of the cytoplasmic TPI under various stresses at different time points, the relative transcript level of OscTPI was determined by quantitative RT-PCR after exposure of 6 h and 24 h in response to high temperature (42°C), drought (RT), wounding, low temperature (4°C), salt stress (NaCl, 200 mM), oxidative stress (H₂O_2, 5 mM), and methylglyoxal (5 mM). The OscTPI transcript was about 2 folds upregulated at 6 h and 24 h following wounding and MG stress. About 1.5 folds upregulation of OscTPI was observed under low temperature and H₂O₂ stress at 6 h, the transcript level dramatically decreased to 0.3 folds when stress persisted for 24 h. Since relative expression ratio of OscTPI was less than 1, it showed a consistent 0.6–0.8 fold downregulation in case of heat, drought and NaCl after 6 h and 24 h after treatment (Fig. 5A).

Figure 5. Real-Time PCR analysis to confirm transcript response. (A) Real-time PCR analysis for transcript of cytosolic TPI gene in response to different abiotic stresses in rice (Oryza sativa L. cv IR64). The analysis was done with cDNA template generated from (A) shoot tissue of 12 d old stressed or control seedlings for 6 h and 24 h and (B) 12 d old seedlings subjected to various concentration of MG for 24 h. The bars above or below 1 shows the transcript upregulation and downregulation, respectively

Transcript level for OscTPI were also measured in the12 d old rice seedlings given various MG stress (0, 5, 10, 15 and 20 mM) for 24 h (Fig. 5B) and transcript level was found upregulated increasing concentration of MG.

In planta enzyme activity of OscTPI under various stresses

As TPI shows higher transcript level under stress, we checked if this results in the higher enzyme activity. The specific activity was measured under similar conditions of stress treatment as given for measuring the transcript level in rice seedlings. Both root and shoot tissues were harvested after 6 and 24 h of treatment and native TPI activity was monitored. It was found that TPI activity was higher in shoots under MG, wounding and salt stress at both the time points. However, under oxidative stress, higher TPI activity was observed after 6 h which decreased by 24 h. It was also noticed that enzyme activity declined marginally at both the time points when seedlings were subjected to other stresses such as low temperature, drought and heat. In case of MG stress, it showed a good correlation with the transcript level (Fig. 6A). In case of roots also, similar pattern of TPI activity was observed with higher activity under MG, wounding and NaCl stress while the enzyme activity declined in case of cold, drought and heat stress (Fig. 6B).

Figure 6. Determination of specific activity of the native OscTPI under MG and other stresses. Rice seedlings were subjected to various stresses, for 6 and 24h. Specific activities were measured using crude proteins (A) 12 d old shoot. (B) 12 d old root (C) Specific activity under various concentration of MG (D) western blot hybridization assay using crude protein extracted from shoot under different MG concentration (E) Activity staining assay for OscTPI where TPI activity bands appear dark over a fluorescent background.

To confirm the effect of MG, TPI activity was measured using 12 d old rice seedlings exposed to different concentrations of MG for 24 h. We found that activity linearly increased with the increase of MG concentration (Fig. 6C). The TPI activity assay was also performed on native PAGE³⁴ using total protein isolated from non-stressed and MG stressed shoot tissues (Fig. 6E) which reconfirmed the higher activity of TPI under MG stress as compared with control.

To check if the increase in the enzyme activity is due to the increase in protein level, western blot was performed using the same tissues from which activity was measured. Data given in Figure 6D shows an increase in overall protein level with an increase in MG concentration.

Discussion

TPI, a glycolytic enzyme, is well studied in animal systems. However, not much is known about its role in plants. Earlier cytoplasmic TPI (cTPI) has been particularly characterized and purified from Solanum chacoense³⁴ and Spinach oleracea.³⁵ In this work, we report biochemical characterization of cytoplasmic TPI from rice and its regulation under abiotic stress.

The rice TPI located on chromosome I was cloned and characterized. Amino acid sequences of TPIs from various organisms were found highly conserved and showed about 60–80% homology to plants such Zea mays, Arabidopsis thaliana, Hordeum vulgare and Solanum tuberosum. We also found by Complementation assay that rice TPI can complement the yeast TPI partially. This partial complementation could be because the protein sequence for both the organisms shares only 55–60% homology. However, the kinetic properties of OscTPI values nearly similar to other cTPIs from plants such as Solanum chacoense³³ and Spinach oleracea.³⁵ The values nevertheless are lower than the Km of TPI from Homosapiens sapiens,^36,37 Oryctolagus cuniculus³⁸ and Saccharomyces cerevisae.³⁹ A low Km value means that the enzyme has a high affinity for the substrate i.e., less concentration of substrate is enough to run the reaction at half its max speed. TPI is a non-allosteric glycolytic enzyme which performs isomerization of DHAP and GAP at pH 8.⁴⁰ It has been reported that the key component of the active site of TPI is the catalytic base (Glu 167) as well as electrostatic stabilization.⁴¹ It has also been reported that TPI is a very efficient enzyme.⁴² For example, the rate of conversion of D-GAP-to-DHAP is diffusion controlled; meaning that kcat/Km in this direction is close to its maximum possible value of 10⁹ M-¹ s-.¹

Previous reports have shown that TPI in plants occurs in the cytosol and in the plastid fraction^43,44 In fact both the isoforms have been separated and studied in pea,⁴⁴ spinach, lettuce, celery, and broccoli.¹³ To confirm that the OscTPI is cytoplasmic in nature, localization assay was performed using the PEG mediated protoplast transfection which clearly indicated that it is evenly distributed in the cytosol. Localization of OscTPI was also confirmed using onion peel bombardment assay and fluorescence microscopy. We also performed cellular fractionation from rice seedlings and reconfirmed the cytoplasmic nature of OscTPI by western blot hybridization.

Rice cytosolic TPI has been reported to show higher transcript level under submergence⁴⁵ and salt stress.⁴⁶ Most of the other glycolytic enzymes also show higher activity under hypoxia and anoxia stress in rice.⁴⁷ Even water stress induces TPI in maize⁴⁸while no significant change has been observed in activity of TPI under salt stress in pea.⁴⁹ In the present study, we did not see significant upregulation in TPI transcript under NaCl (200 mM) stress. This difference could be due to the use of rice seedlings at different age, stress treatment schedule and the genotype etc. (As we have used IR64, a salt sensitive variety while Kawasaki et al. used Pokkali, which is a salt tolerant variety) under different conditions.

Our data confirms the upregulation of OscTPI under wound and MG stress, however, it was most prominent in case of MG where about 2-folds increase in the transcript level at 6 and 24 h of stress was recorded (Fig. 5A). Interestingly, when transcript was checked from the rice seedling given various MG stress, TPI showed increase in transcript level from 0 mM to 20 mM MG (Fig. 5B). Earlier, cytoplasmic TPI in yeast is reported to increase 7-folds under MG stress.⁵⁰ In humans also, it has been shown that MG causes a significant increase in transcript and protein expression of the nervous growth factor (NGF) as well as of the pro-inflammatory cytokine IL-1β, a major inducer of the acute phase response.⁵¹ Though we could not find any reports where MG induces TPI particularly, it has been shown that MG induced a dose- and time-dependent increase in aldose reductase (AR) mRNA level in rat aortic smooth muscle cells.⁵²

Western blot hybridization and enzyme activity of TPI also showed a linear correlation between the TPI transcripts, protein level and enzyme activity under MG stress. This correlation was also observed under drought, heat and wound stress. However, in case of salinity stress, a downregulation was observed at the transcript level while the TPI enzyme activity was found to be slightly higher. The difference between transcript level and the enzyme activity is possibly due to the post-translational modification. Studies have shown that the correlation between protein and transcript expression levels can vary significantly based upon the profiling approach used and the system being analyzed.⁵³ Many specific examples of discordant protein/ transcript expression patterns have also been detected recently revealing examples of posttranslational regulation.⁵⁴

We have previously shown that in response to stress, there is an increase in MG level²⁵ which is quite deleterious to plant growth. Our earlier studies also shows that seed germination, shoot and root growth is severely affected by exogenous application of MG. Inhibitory effect of exogenous MG on seed germination in barley has also been demonstrated in 1970s by Mankikar and Rangekar.⁵⁵ Our present data now indicates that there is an upregulation of TPI transcript, protein and enzyme activity under various concentration of MG. We perceive that in order to rescue the stress, the increase in MG activates the TPI which shifts the reaction toward the formation of GAP, thus decreasing the concentration of DHAP. Once DHAP level goes down, the amount of MG present in the system will decrease and hence the plant could survive under stress. Higher level of MG has been previously shown to induce several glycolytic enzymes such as, phosphoglucose isomerase (PGI), phosphofructokinase (PFK) and triosephosphate isomerase (TPI) in yeast.⁵⁰ It is also possible that due to increase in TPI, the amount of GAP will increase in the system which can positively affect the energy level in plant and thus support the plant survival.

Our present results elucidate that MG could act as a signal molecule to induce the expression of TPI in rice. The increase of TPI under MG stress, on one hand, decreases the level of MG by feedback mechanism, and on the other hand increases the concentration of GAP, and thus increasing the energy status of the plant against the stress consequences. This could be one of the mechanisms to defend the plant system from abiotic streses.

Materials and Methods

Genomic distribution of TPI genes on rice chromosomes

Position of each of the TPI genes on rice chromosome pseudomolecules available at TIGR version 6.1 (http://rice.plantbiology.msu.edu/cgi-bin/ORF_infopage.cgi) was determined by BLASTn search.

Multiple alignment and phylogenetic analyses of TPI

Multiple alignments of all the isoforms of rice TPI proteins were performed using ClustalW2 program.⁵⁶ For phylogenetic analysis, sequence from different organisms such as Arabidopsis thaliana, Solanum tubereosum, Hordeum vulgare, Zea mays Oryza sativa, Oryctolagus cuniculus, Homosapiens sapiens, Saccharomyces cerevisiae and Escherichia coli were taken and unrooted tree was generated for cytoplasmic TPI using neighbor joining method employing Mega4 software.

Expression analysis using Rice Genome database

For microarray analysis of rice TPI genes, Gene Expression Omnibus platform (http://www.ncbi.nlm.nih.gov/geo/) accession number GSE6893 was used and heatmap was generated using the Institute for Genomic Research MeV software package. Here, different stages of panicle and seed development have been categorized according to panicle length and days after pollination, respectively, based on landmark developmental events as follows: up to 0.5 mM, shoot apical meristem and rachis meristem (SAM); 0–3 cm, floral transition and floral organ development (P1); 3–10 cm, meiotic stage (P2 and P3); 10–15 cm, young microspore stage (P4); 15–22 cm, vacuolated pollen stage (P5); 22–30 cm, mature pollen stage (P6); 0–2 DAP, early globular embryo (S1); 3–4 DAP, middle and late globular embryo (S2); 5–10 DAP, embryo morphogenesis (S3); 11–20 DAP, embryo maturation (S4); 21–29, dormancy and desiccation tolerance (S5).⁵⁷

Plant material, growth conditions and sample collection

Plants of rice cultivar IR64 were grown in controlled conditions in growth chamber at 28 ± 2°C and 16 h photoperiod. The seeds were surface sterilized with 1% Bavistin for 20 min and allowed to germinate hydroponically with modified Yoshida medium.⁵⁸ Various stress treatments including low temperature (4°C), Drought, Sodium chloride (200 mm), MG (5 mM), High temperature (42°C), H₂O₂ and wound were given to the 12 d old plant seedlings and tissues were harvested after 6 and 24 h of stress treatment.After 7 d, various chemical treatments (prepared in Yoshida medium) were given. At specific time point, plant tissues were excised, weighed and packed in aluminum foil, labeled properly and then stored in liquid nitrogen till further use. Untreated seedlings served as control.

Cloning of OscTPI from rice

TPI gene was amplified using UTR specific primers (TIGR 6.1) (Table 2) from rice. It was further cloned into TOPO-TA cloning vector (Invitrogen) and sequenced. The full length OscTPI cDNA was amplified with gene specific primers and cloned at BamH1/ Xho1 sites in pET28(a) (Novagen) bacterial expression vector.

Table 2. K_m values for TPI in various organisms

Source of enzyme	Km (mM)
Oryza sativa	0.12 ± 0.025
Solanum tuberosum	0.13 ± 0.014
Trypanosoma brucei	0.25 ± 0.05
Saccharomyces cerevisae	1.22 ± 0.05
Chicken muscle	0.47 ± 0.05
Oryctolagus cuniculus	0.39 ± 0.05

For localization assay, the OscTPI cDNA was cloned in pMB-PII localization vector at Xba/BamH1 sites.

OscTPI full length cDNA was also cloned in pYES2 yeast expression vector (Invitrogen) at HindIII/BamH1 for yeast complementation assay.

Expression and purification of OscTPI (LOC_Os01 g62420) recombinant protein

The pET28aOscTPI construct was transformed in to BL21 (DE3) E. coli cells. The transformed cells were grown on LB medium till the OD reached about 0.5 and induced with 0.3 mM IPTG at 37°C for 4 h. OscTPI recombinant protein was purified from pellet of 500 ml bacterial culture. The pellet was dissolved and sonicated in 20 ml sonication buffer and centrifuged. The clear lysate was collected, mixed with 2 ml Ni-NTA agarose slurry by shaking gently (200 rpm on a rotary shaker) at 4°C for 60 min. The lysate–Ni-NTA mixture was loaded into a column and the protein was eluted 10 times with 1.0 ml elution buffer (50 mM sodium phosphate buffer pH 8.0, 10% glycerol, 300 mM NaCl, 1 mM PMSF, 100 mM Imidazole). The eluted fractions were analyzed by SDS-PAGE.

Determination of Specific activity and kinetic parameters of OscTPI

Specific activity of OscTPI was assayed with glyceraldehyde 3-phosphate as substrate. As previously reported,⁵⁹ dihydroxyacetone phosphate productions was coupled to NADH oxidation via α-glycerol phosphate dehydrogenase. Reaction mixture containing 100 mM triethanolamine hydrochloride, 10 mM EDTA, 1 mM dithiothreitol, pH 7.4, containing 0.2 mM NADH, 20 ng α-glycerol phosphate dehydrogenase and 0.1 -2 mM D-glyceraldehyde 3- phosphate was initiated by the addition of 50 ng of purified recombinant protein.The initial rate was calculated from the change in NADH absorbance at 340 nm with spectrophotometer. All experiments were performed at 25°C.

Kinetic studies for rice TPI was performed using the reaction mixture containing 0.03 mM NADH, 0.4 mM D-glyceraldehyde-3-phosphate and variable concentrations of glyceraldehyde 3-phosphate between 0.05 mM and 2.0 mM and 600 ng of purified triosephosphate isomerase in a final volume of 1 ml.

Functional complementation of yeast TPI (Tim) mutant with OscTPI

OscTPI gene was cloned in the yeast expression vector pYES2 downstream to GAL1 promoter. S. cerevisiae cells BY4741 (Mat a., his3Δ1 leu2Δ0 met15Δ0 ura3Δ0), BY4741ΔTIMI (Mat a., his3Δ1. leu2Δ0. met15Δ0. ura3Δ0. YHR057c::kanMX4) were transformed with either pYES2 alone or pYES2OscTPI and transformants were picked up by Ura prototrophy. For comparing the growth profile of these strains, cells were streaked on solid Ura^- SD plate supplemented with either 20% glucose or 20% galactose and grown at 30°C and 37°C for 48 h-72 h.

Protoplast isolation and localization of TPI

Protoplast isolation and transfection for OscTPI was performed following the method of Sheen et al.⁶⁰ Soft and young leaves from 25 d old tobacco plants were sliced and mixed with a total of 30 ml cell wall lysis enzyme (1% cellulase Y-C, 0.1% macerozyme, (Kyowa Chemical Products, Osaka, Japan), 0.4 M mannitol, 5 mM MES, pH 5.7, filter sterilized). The mixture was incubated in a small Petridish at 25°C for 3 h in dark and rotated at (60 rpm). Protoplasts were then transferred to 2 × 50-ml corex tubes and centrifuged at low speed (145 g, Eppendorf 5810R) for 2 min. After removal of the supernatant, the protoplasts were washed thrice in 20 ml wash buffer (0.4 M mannitol, 2.5 mM CaCl₂, 1 mM MES, pH 5.7) via consecutive resuspension and centrifugation. Finally, the protoplasts were resuspended in 20 ml solution containing 0.4 m mannitol, 15 mM MgCl₂, 5 mM MES, pH 5.7. This procedure usually yielded 10⁵ to 10⁶ protoplasts per ml. After removal of the supernatant, the protoplasts were diluted in a solution containing 154 mM NaCl, 125 mM CaCl₂ 5.0 mM KCL, 2.0 mM MES (pH 5) and 2.0 µg of TPI-pMBGFP plasmid was added along with the 40% PEG and mixed gently. The mixture was then incubated for 20 h at 23°C with gentle agitation. The next d, incubation buffer was removed and protoplasts were viewed via confocal microscopy.

Particle bombardment and flourescence microscopy

Onion Peel Bombardment assay was performed following the method of Singh et al.⁶¹ Onion epidermal peels were taken out carefully from the surface of young spring onion bulbs and placed on ½ MS-agar plates containing 1% sucrose. About 3 µg of TPI-GFP plasmid was coated with 1 µm gold particle and introduced transiently into onion epidermal cells by microprojectile bombardment, using a Bio-Rad PDS/1000 helium-driven particle accelerator, as per manufacturer's instructions. Plate was incubated at 28°C for 18 h in dark before microscopic analysis. Transformed epidermal onion peels were observed under fluorescence microscope. GFP signals were detected between 505–550 nm after exciting with 488 nm.

Native protein isolation and TPI Activity in plants

TPI activity was assayed with D-glyceraldehyde-3- phosphate and glycerophosphate dehydrogenase as a coupling enzyme followed by measuring the decrease in OD at 340 nm.⁶² Specific activity of TPI was also measured in 12 d old rice seedlings (IR64) exposed to stress conditions. Native protein was assayed following extraction with buffer containing 0.1 M sodium phosphate buffer, pH 7.0., 50% glycerol, 16 mM MgSO₄, 0.2 mM PMSF and 0.2% PVPP. Protein was quantified using Bradford method and the supernatant was immediately used for TPI assay. Two microgram of crude protein was added to the reaction mixture containing 0.03 mM NADH, 0.4 mM D-glyceraldehyde-3-phosplhate and one unit of glycerophosphate dehydrogenase. A time scan was performed spectrophotometrically, taking the OD₃₄₀ at every 10 sec within a time scale that showed a linear increase in absorbance. The molar absorption coefficient of NADH at 340 nm is 6.3 × 10³ m⁻¹cm⁻¹. The specific activity of the enzyme was expressed in µm/min/mg of protein.

Native PAGE was performed on 10% acrylamide gels and TPI activity was assayed. The gel was stained as described by Pichersky and Gottlieb.¹³ Briefly, after native electrophoresis, gels were incubated for 20 min in equilibration buffer (0.1 M Tris–Cl pH 7.5, 0.5 mM EDTA and 0.2 mM NADH) with gentle agitation. The gel was then transferred to developing buffer containing 0.1 M Tris–Cl pH 7.5, 1 mM GAP, 0.5 mM EDTA, 0.2 mM NADH and 3 U/mL /- GPDH. When viewed over a UV transilluminator, TPI isozymes appeared within 2–5 min as dark bands over a fluorescent background. Control gels were incubated without GAP that did not show any activity band even when incubated for up to 60 min.

Cell Fractionation

Preparation of nuclear extract

Nuclear extracts were prepared according to the method described previously.⁶³ 12 d old rice seedlings were homogenized and extracted using cold buffer containing 0.55 M sucrose, 50 mM Tris ± Cl pH 8.0 and 10 mM MgCl2 and the homogenate was passed through two layers of cheesecloth and two layers of Miracloth. The filtrate was then centrifuged at 1000 g for 10 min at 4°C and pellet was slowly resuspended in STM containing 2.5% TritonX100, and incubated at 4°C with slow shaking followed by centrifugation at 2000 g for 30 min at 4°C. The resulting nuclear pellet was then resuspended in a buffer containing 600 mM KCl, 50 mM Tris ± Cl pH 7.9, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM DTT, 25% glycerol, 0.5 mM PMSF, 50 mM leupeptin and 1 mM pepstatin, and the homogenate was spun at 12 000 g for 30 min at 4°C, and the clear supernatant (nuclear extract) was dialysed against buffer containing 50 mM KCl, 50 mM Tris ± Cl pH 8, 20% glycerol and protease inhibitors, and stored at ± 80°C.

Preparation of chloroplast lysate

Chloroplast lysate was prepared by the method earlier described earlier.⁶⁴ Briefly, 12 d old rice seedlings were homogenized and extracted in buffer containing 0.5 M sucrose, 50 mM Tris/HCl, pH 8.0, 10 mM MgCl,, 10 mM 2- mercaptoethanol, 0.3 mM phenylmethylsulfonyl fluoride, 1 mM sodium bisulfite and I mg/ml benzamidine . The homogenate was filtered and filtrate was centrifuged for 10 rnin at 1000 g and the pellet suspended in 120 ml of the above buffer. To disrupt the chloroplast, 30 ml 12.5% Triton X-100 was added to the chloroplast suspension. The mixture was kept on ice for 45 min, stirred occasionally and centrifuged at 3000 g for 15 min. Chloroplast lysate was used for western blot hybridization.

Western Blot Hybridization

Western blot assay was performed as described previously.⁶⁵ Proteins separated on SDS-PAGE were transferred to Hybond-C⁺ membrane (GE Healthcare) using Mini Transblot Electrophoretic cell (Biorad, USA). Electroblotting buffer consisted of 150 mM glycine, 20 mM Tris and 20% methanol (pH 8.0). The blot was incubated in blocking solution (5% non-fat dried milk dissolved in PBS) for 45 min and then washed with 0.1% PBST. Blot was further incubated with primary antibodies at specific dilution with blocking buffer for 1 h followed by incubation in Alkaline-Phosphatase conjugated secondary antibodies (diluted in blocking buffer) for 1 h. After washing, The protein-antibody complex was developed in 5-bromo-4-chloro-3-indolyl phosphate (BCIP) / nitroblue tetrazolium (NBT) containing solution (0.1 M TRIS-HCl pH 9.5, 0.1 M NaCl, 5 mM MgCl₂ containing 150 µg/ml of NBT and 75 µg/ml of BCIP). The reaction was stopped by rinsing the blot with water.

Real time PCR

Real Time PCR was performed as previously standardized and described.⁶⁶ Total RNA was isolated from the shoot tissues of control and stressed seedlings using RaFlex™ solution I and solution II (GeNei, India), and cDNA synthesis was performed with RevertAid™ RNase H minus cDNA synthesis kit (Fermentas Life Sciences, USA). Manufacturer’s protocol was strictly followed in both the above procedures. Real time PCR primers for OscTPI were designed from 3′ UTR regions using Primer3 software. cDNA was further diluted 50 times and reaction mixture was prepared adding 5 μl of diluted cDNA, 12.5 μl of 2 × SYBR Green PCR Master Mix (Applied Biosystems, USA) and 200 nM of each gene-specific primer in a final volume of 25 μl. ABI Prism 7500 Sequence Detection System was used for qRT-PCR for 2 min a 50°C, 10 min at 95°C,and 40 cycles of 15 sec at 95°C, 1 min at 57°C, and 30 sec at 72°C in 96-well optical reaction plates (Applied Biosystems). Three technical replicates were analyzed and amplification was checked using dissociation graph, and relative expression ratio was calculated using comparative Ct value method.⁶⁷

Disclosure of Potential Conflicts of Interest

No potential conflicts of interest were disclosed.