Advanced search
Publication Cover
Hemoglobin
international journal for hemoglobin research
Volume 33, 2009 - Issue 3-4
Submit an article Journal homepage
91
Views
8
CrossRef citations to date
0
Altmetric
Original Article

Three New β-Thalassemia Mutations with Varying Degrees of Severity

Hannes Frischknecht Institute for Medical & Molecular Diagnostics Ltd, Zürich, Switzerland
,
Fabrizio Dutly Institute for Medical & Molecular Diagnostics Ltd, Zürich, Switzerland
,
Lynda Walker Department of Pathology and Molecular Medicine, McMaster University, Hamilton, Ontario, Canada
,
Lisa M. Nakamura-Garrett Department of Pathology and Molecular Medicine, McMaster University, Hamilton, Ontario, Canada
,
Barry Eng Department of Pathology and Molecular Medicine, McMaster University, Hamilton, Ontario, Canada
&
John S. Waye Department of Pathology and Molecular Medicine, McMaster University, Hamilton, Ontario, Canada; Hamilton Regional Laboratory Medicine Program, Hamilton Health Sciences, Hamilton, Ontario, CanadaCorrespondence[email protected]
Pages 220-225 | Received 09 Feb 2009, Accepted 26 Mar 2009, Published online: 15 Sep 2009

Citations (8)

Keep up to date with the latest research on this topic with citation updates for this article.

Subscribe to citation updates

Read on this site (1)

Huan-Qing Chen, Li-Sha Wu, Fan Jiang & Dong-Zhi Li. (2021) Dominant β-Thalassemia Phenotype Caused by Hb Dieppe (HBB: c.383A>G): Another Case Report. Hemoglobin 45:5, pages 329-331.
Read now

Articles from other publishers (7)

Ekta Rao, Sandip Kumar Chandraker, Mable Misha Singh & Ravindra Kumar. (2024) Global distribution of β-thalassemia mutations: An update. Gene 896, pages 148022.
Crossref
Wanying Lin, Qianqian Zhang, Zongrui Shen, Xiang Qu, Qi Wang, Liuyuan Wei, Yuhao Qiu, Jie Yang, Xiangmin Xu & Jinquan Lao. (2021) Molecular and phenotype characterization of an elongated β‐globin variant produced by HBB:C.313delA. International Journal of Laboratory Hematology 43:6, pages 1620-1627.
Crossref
Jin-Huan Lin, Hao Wu, Wen-Bin Zou, Emmanuelle Masson, Yann Fichou, Gerald Le Gac, David N. Cooper, Claude Férec, Zhuan Liao & Jian-Min Chen. (2021) Splicing Outcomes of 5′ Splice Site GT>GC Variants That Generate Wild-Type Transcripts Differ Significantly Between Full-Length and Minigene Splicing Assays. Frontiers in Genetics 12.
Crossref
Jian-Min Chen, Jin-Huan Lin, Emmanuelle Masson, Zhuan Liao, Claude Férec, David N. Cooper & Matthew Hayden. (2020) The Experimentally Obtained Functional Impact Assessments of 5' Splice Site GT>GC Variants Differ Markedly from Those Predicted. Current Genomics 21:1, pages 56-66.
Crossref
Jin‐Huan Lin, Xin‐Ying Tang, Arnaud Boulling, Wen‐Bin Zou, Emmanuelle Masson, Yann Fichou, Loann Raud, Marlène Le Tertre, Shun‐Jiang Deng, Isabelle Berlivet, Chandran Ka, Matthew Mort, Matthew Hayden, Raphaël Leman, Claude Houdayer, Gerald Le Gac, David N. Cooper, Zhao‐Shen Li, Claude Férec, Zhuan Liao & Jian‐Min Chen. (2019) First estimate of the scale of canonical 5′ splice site GT>GC variants capable of generating wild‐type transcripts. Human Mutation 40:10, pages 1856-1873.
Crossref
L. C. Rizo‐de‐la‐Torre, B. Ibarra, J. Y. Sánchez‐López, M. T. Magaña‐Torres, V. M. Rentería‐López & F. J. Perea‐Díaz. (2017) Three novel HBB mutations, c.‐140C>G (‐90 C>G), c.237_256del GGACAACCTCAAGGGCACCT ( FS Cd 78/85 ‐20 bp), and c.315+2T>G ( IVS 2:2 T>G). Update of the mutational spectrum of β‐Thalassemia in Mexican mestizo patients . International Journal of Laboratory Hematology 39:5, pages 539-545.
Crossref
R. Angalena, S. Aggarwal, S. R. Phadke & A. Dalal. (2012) Compound heterozygote condition in beta thalassemia major due to a novel single nucleotide deletion (–T) at codon 69 in association with IVS 1‐5 (G>C) mutation. International Journal of Laboratory Hematology 34:4.
Crossref

Reprints and Corporate Permissions

Please note: Selecting permissions does not provide access to the full text of the article, please see our help page How do I view content?

To request a reprint or corporate permissions for this article, please click on the relevant link below:

Order Reprints Request Corporate Permissions

Academic Permissions

Please note: Selecting permissions does not provide access to the full text of the article, please see our help page How do I view content?

Obtain permissions instantly via Rightslink by clicking on the button below:

Request Academic Permissions

If you are unable to obtain permissions via Rightslink, please complete and submit this Permissions form. For more information, please visit our Permissions help page.

Related research

People also read lists articles that other readers of this article have read.

Recommended articles lists articles that we recommend and is powered by our AI driven recommendation engine.

Cited by lists all citing articles based on Crossref citations.
Articles with the Crossref icon will open in a new tab.