Publication Cover
Hemoglobin
international journal for hemoglobin research
Volume 36, 2012 - Issue 3
152
Views
11
CrossRef citations to date
0
Altmetric
Original Article

Molecular Spectrum of β-Thalassemia Mutations in the admixed Venezuelan population, and their linkage to β-Globin Gene Haplotypes

, , , , , , , , , , & show all
Pages 209-218 | Received 22 Nov 2011, Accepted 04 Feb 2012, Published online: 07 May 2012

Keep up to date with the latest research on this topic with citation updates for this article.

Read on this site (6)

Ahmet Genc, Deniz Tastemir Korkmaz, Suleyman Bayram & Eyyup Rencuzogullari. (2020) The Effect of Five Single Nucleotide Polymorphisms on Hb F Variation of β-Thalassemia Traits and Hematologically Normal Individuals in Southeast Turkey. Hemoglobin 44:4, pages 231-239.
Read now
Faten Moassas, Ayman Alabloog & Hossam Murad. (2018) Description of a Rare β-Globin Gene Mutation: –86 (C>G) (HBB: c.-136C>G) Observed in a Syrian Family. Hemoglobin 42:3, pages 203-205.
Read now
Aylla N. L. M. Silva, Greice L. Cardoso, Daniele A. Cunha, Isabela G. Diniz, Sidney E.B. Santos, Gabriela B. Andrade, Saide M.S. Trindade, Maria do Socorro O. Cardoso, Larissa T.V.M. Francês & João F. Guerreiro. (2016) The Spectrum of β-Thalassemia Mutations in a Population from the Brazilian Amazon. Hemoglobin 40:1, pages 20-24.
Read now
Sheng He, Qian Qin, Shang Yi, Wanjun Zhou, Jianping Deng, Chenguang Zheng & Biyan Chen. (2015) First Description of a β-Thalassemia Mutation, −86 (C > G) (HBB: c.−136C > G), in a Chinese Family. Hemoglobin 39:6, pages 448-450.
Read now
Rakesh Kumar, Chandan Sagar, Dharmesh Sharma & Purnima Kishor. (2015) β-Globin Genes: Mutation Hot-Spots in the Global Thalassemia Belt. Hemoglobin 39:1, pages 1-8.
Read now
Sandra S. Lazarte, María E. Mónaco, Ana C. Haro, Cecilia L. Jiménez, Myriam E. Ledesma Achem & Blanca A. Issé. (2014) Molecular Characterization and Phenotypical Study of β-Thalassemia in Tucumán, Argentina. Hemoglobin 38:6, pages 394-401.
Read now

Articles from other publishers (5)

Ekta Rao, Sandip Kumar Chandraker, Mable Misha Singh & Ravindra Kumar. (2024) Global distribution of β-thalassemia mutations: An update. Gene 896, pages 148022.
Crossref
Camila Cruz de Martino, Cecilia Salete Alencar, Paula Loureiro, Anna Barbara de Freitas Carneiro-Proietti, Claudia de Alvarenga Máximo, Rosimere Afonso Mota, Daniela Oliveira Werneck Rodrigues, Nelson Gaburo Junior, Shannon Kelly & Ester Cerdeira Sabino. (2019) Use of an automated pyrosequencing technique for confirmation of sickle cell disease. PLOS ONE 14:12, pages e0216020.
Crossref
Xin-Yu Li, Xin Sun, Jing Chen, Mao-Quan Qin, Zuo Luan, Yi-Ping Zhu & Jian-Pei Fang. (2018) Hematopoietic stem cell transplantation for children with β-thalassemia major: multicenter experience in China. World Journal of Pediatrics 14:1, pages 92-99.
Crossref
L. C. Rizo‐de‐la‐Torre, B. Ibarra, J. Y. Sánchez‐López, M. T. Magaña‐Torres, V. M. Rentería‐López & F. J. Perea‐Díaz. (2017) Three novel HBB mutations, c.‐140C>G (‐90 C>G), c.237_256del GGACAACCTCAAGGGCACCT ( FS Cd 78/85 ‐20 bp), and c.315+2T>G ( IVS 2:2 T>G). Update of the mutational spectrum of β‐Thalassemia in Mexican mestizo patients . International Journal of Laboratory Hematology 39:5, pages 539-545.
Crossref
Marianne E. M. Yee, Maa-Ohui Quarmyne, Catherine Segbefia, Andrew N. Young, Lina Zhuang & Ferdane Kutlar. (2016) Hemoglobin F Only Syndrome at Birth. Journal of Pediatric Hematology/Oncology 38:1, pages e32-e34.
Crossref

Reprints and Corporate Permissions

Please note: Selecting permissions does not provide access to the full text of the article, please see our help page How do I view content?

To request a reprint or corporate permissions for this article, please click on the relevant link below:

Academic Permissions

Please note: Selecting permissions does not provide access to the full text of the article, please see our help page How do I view content?

Obtain permissions instantly via Rightslink by clicking on the button below:

If you are unable to obtain permissions via Rightslink, please complete and submit this Permissions form. For more information, please visit our Permissions help page.