Advanced search
Publication Cover
Hemoglobin
international journal for hemoglobin research
Volume 36, 2012 - Issue 5
Submit an article Journal homepage
290
Views
35
CrossRef citations to date
0
Altmetric
Original Article

The Spectrum of α- And β-Thalassemia Mutations in Yunnan Province of Southwestern China

Jie Zhang Genetic Diagnosis Center, Yunnan Provincial Key Laboratory For Birth Defects and Genetic Diseases, The First People’s Hospital of Yunnan Province, Kunming 650032, People’s Republic of China
,
Bao-Sheng Zhu Genetic Diagnosis Center, Yunnan Provincial Key Laboratory For Birth Defects and Genetic Diseases, The First People’s Hospital of Yunnan Province, Kunming 650032, People’s Republic of ChinaCorrespondence[email protected]
,
Jing He Genetic Diagnosis Center, Yunnan Provincial Key Laboratory For Birth Defects and Genetic Diseases, The First People’s Hospital of Yunnan Province, Kunming 650032, People’s Republic of China
,
Xiao-Hong Zeng Genetic Diagnosis Center, Yunnan Provincial Key Laboratory For Birth Defects and Genetic Diseases, The First People’s Hospital of Yunnan Province, Kunming 650032, People’s Republic of China
,
Jie Su Genetic Diagnosis Center, Yunnan Provincial Key Laboratory For Birth Defects and Genetic Diseases, The First People’s Hospital of Yunnan Province, Kunming 650032, People’s Republic of China
,
Xiang-Hu Xu Genetic Diagnosis Center, Yunnan Provincial Key Laboratory For Birth Defects and Genetic Diseases, The First People’s Hospital of Yunnan Province, Kunming 650032, People’s Republic of China
,
Su-Yun Li Genetic Diagnosis Center, Yunnan Provincial Key Laboratory For Birth Defects and Genetic Diseases, The First People’s Hospital of Yunnan Province, Kunming 650032, People’s Republic of China
,
Hong Chen Genetic Diagnosis Center, Yunnan Provincial Key Laboratory For Birth Defects and Genetic Diseases, The First People’s Hospital of Yunnan Province, Kunming 650032, People’s Republic of China
&
Ying-Hong Zhang Genetic Diagnosis Center, Yunnan Provincial Key Laboratory For Birth Defects and Genetic Diseases, The First People’s Hospital of Yunnan Province, Kunming 650032, People’s Republic of China
 show all
Pages 464-473 | Received 18 Jan 2012, Accepted 18 May 2012, Published online: 19 Sep 2012

Citations (35)

Keep up to date with the latest research on this topic with citation updates for this article.

Subscribe to citation updates

Read on this site (9)

Mina Ebrahimi, Javad Mohammadi-Asl & Fakher Rahim. (2021) The worldwide molecular spectrum and distribution of thalassaemia: a systematic review. Annals of Human Biology 48:4, pages 307-312.
Read now
Qiang Zhao, Su-Min Zhao, Xue Zhang, Shi-Ping Chen, Jun Sun, Zhi-Yu Peng, Yan Sun, Chuang Fan, Xiao-Dan Xing & Rong Li. (2021) Detection of the HBB: c.393T>G Mutation in Two Patients with Hypochromic Microcytic Anemia. Hemoglobin 45:3, pages 150-153.
Read now
Reza Alibakhshi, Keivan Moradi, Mozaffar Aznab, Zahra Dastafkan, Susan Tahmasebi, Mahsa Ahmadi & Leila Omidniakan. (2020) The Spectrum of α-Thalassemia Mutations in Kurdistan Province, West Iran. Hemoglobin 44:3, pages 156-161.
Read now
Qiong Su, Shiping Chen, Liusong Wu, Runmei Tian, Xiaoqin Yang, Xiaoyan Huang, Yan Chen, Zhiyu Peng & Jindong Chen. (2019) Severe Thalassemia Caused by Hb Zunyi [β147(HC3)Stop→Gln; HBB: c.442T>C)] on the β-Globin Gene. Hemoglobin 43:1, pages 7-11.
Read now
Maria G. Doro, Giuseppina Casu, Laura Frogheri, Ivana Persico, Le Phan Minh Triet, Phan Thi Thuy Hoa, Nguyen Huy Hoang, Monica Pirastru, Paolo Mereu, Francesco Cucca & Bruno Masala. (2017) Molecular Characterization of β-Thalassemia Mutations in Central Vietnam. Hemoglobin 41:2, pages 96-99.
Read now
Xia Yu, Li-Ye Yang, Hui-Tian Yang, Cheng-Gui Liu, Deng-Cheng Cao, Wei Shen, Hui Yang, Xiao-Fen Zhan, Jian Li, Bing-Rong Xue & Min Lin. (2015) Molecular Epidemiological Investigation of Thalassemia in the Chengdu Region, Sichuan Province, Southwest China. Hemoglobin 39:6, pages 393-397.
Read now
Sheng-Wen Huang, Yin Xu, Xing-Mei Liu, Man Zhou, Gui-Fang Li, Bang-Quan An, Li Su, Xian Wu & Jing Lin. (2015) The Prevalence and Spectrum of α-Thalassemia in Guizhou Province of South China. Hemoglobin 39:4, pages 260-263.
Read now
Ge Huang, Ping Li, Yun-Xiong Li & Lian-Zhen Ye. (2014) Coexistence of Two β-Globin Gene Deletions in a Chinese Girl with β-Thalassemia Minor. Hemoglobin 38:1, pages 70-72.
Read now
Hailong Huang, Liangpu Xu, Na Lin, Deqin He, Yin Li, Danhua Guo, Linshuo Wang, Yan Wang, Lin Zhen, Jinbang Xu & Yuan Lin. (2013) Molecular Spectrum of β-Thalassemia in Fujian Province, Southeastern China. Hemoglobin 37:4, pages 343-350.
Read now

Articles from other publishers (26)

Xingmin Wang, Haoyang Huang, Yanling Zhao, Yuqiu Zhou, Qianqian Zhang & Ge Wang. (2023) Molecular spectrum of α‐ and β‐thalassemia among individuals of reproductive age in the Zhuhai region of southern China. International Journal of Laboratory Hematology 45:4, pages 571-580.
Crossref
Wei-da Wang, Fang Hu, Dun-hua Zhou, Robert Peter Gale, Yong-rong Lai, Hong-xia Yao, Chunfu Li, Bing-yi Wu, Zhu Chen, Jian-pei Fang, Sai-juan Chen & Yang Liang. (2023) Thalassaemia in China. Blood Reviews 60, pages 101074.
Crossref
Hong-Feng Liang, Wei-Min Liang, Wen-Guang Xie, Fen Lin, Li-Li Liu, Lie-Jun Li, Yi-Yuan Ge, Min Lu, Yu-Wei Liao, Guang-Kuan Zeng, Jin-Xiu Yao, Jing-Wei Situ & Li-Ye Yang. (2023) The gene spectrum of thalassemia in Yangjiang of western Guangdong Province. Frontiers in Genetics 14.
Crossref
Shiqiang Luo, Xingyuan Chen, Dingyuan Zeng, Ning Tang, Dejian Yuan, Bailing Liu, Lizhu Chen, Qingyan Zhong, Jiaqi Li, Yinyin Liu, Jianping Chen, Xiaoyuan Wang & Tizhen Yan. (2022) Detection of four rare thalassemia variants using Single-molecule realtime sequencing. Frontiers in Genetics 13.
Crossref
Ying Yu, Chunjiao Lu, Ying Gao, Cuiyun Li, Dongxue Li, Jie Wang, Hui Wei, Zhaohui Lu & Guoling You. (2022) Molecular Spectrum, Ethnic and Geographical Distribution of Thalassemia in the Southern Area of Hainan, China. Frontiers in Pediatrics 10.
Crossref
Heming Wu, Qingyan Huang, Zhikang Yu & Zhixiong Zhong. (2021) Molecular analysis of alpha‐ and beta‐thalassemia in Meizhou region and comparison of gene mutation spectrum with different regions of southern China. Journal of Clinical Laboratory Analysis 35:12.
Crossref
Jianlong Zhuang, Na Zhang, Yuanbai Wang, Hegan Zhang, Yu Zheng, Yuying Jiang, Yingjun Xie & Dongmei Chen. (2021) Molecular Characterization Analysis of Thalassemia and Hemoglobinopathy in Quanzhou, Southeast China: A Large-Scale Retrospective Study. Frontiers in Genetics 12.
Crossref
Sheng He, Dongming Li, Shang Yi, Xiuning Huang, Chaofan Zhou, Biyan Chen, Yangjin Zuo, Li Lin, Faqin Chen & Hongwei Wei. (2021) Molecular Characterization of α- and β-Thalassaemia Among Children From 1 to 10 Years of Age in Guangxi, A Multi-Ethnic Region in Southern China. Frontiers in Pediatrics 9.
Crossref
Xia Yu, Min Lin, Chenggui Liu, Zhiyong Liao, Yongqiong Wei, Rui Liu & Jing Zhu. (2021) Genetic investigation of haemoglobinopathies in a large cohort of asymptomatic individuals reveals a higher carrier rate for β-thalassaemia in Sichuan Province (Southwestern China). Genes & Diseases 8:2, pages 224-231.
Crossref
Yaowu Zhu, Na Shen, Xiong Wang, Juan Xiao & Yanjun Lu. (2020) Alpha and beta-Thalassemia mutations in Hubei area of China. BMC Medical Genetics 21:1.
Crossref
Ti-Long Huang, Tian-Yao Zhang, Chun-Yan Song, Yun-Bi Lin, Bao-Hua Sang, Qing-Ling Lei, Yu Lv, Chun-Hui Yang, Na Li, Xin Tian, Yue-Huang Yang & Xian-Wen Zhang. (2020) Gene Mutation Spectrum of Thalassemia Among Children in Yunnan Province. Frontiers in Pediatrics 8.
Crossref
Jie Zhang, Yang Yang, Peng Li, Yuanlong Yan, Tao Lv, Tingting Zhao, Xiaohong Zeng, Dongmei Li, Xiaoyan Zhou, Hong Chen, Jie Su, Tonghua Yang, Jing He & Baosheng Zhu. (2019) Analysis of deletional hereditary persistence of fetal hemoglobin/δβ‐thalassemia and δ‐globin gene mutations in Southerwestern China. Molecular Genetics & Genomic Medicine 7:6.
Crossref
Zhuo Yang, Quexuan Cui, Wenzhe Zhou, Ling Qiu & Bing Han. (2019) Comparison of gene mutation spectrum of thalassemia in different regions of China and Southeast Asia. Molecular Genetics & Genomic Medicine 7:6.
Crossref
Sheng He, Jihui Li, Dong Ming Li, Shang Yi, Xiongcai Lu, Yudi Luo, Yi Liang, Chunfeng Feng, Biyan Chen, Chenguang Zheng & Xiaoxia Qiu. (2018) Molecular characterization of α- and β-thalassemia in the Yulin region of Southern China. Gene 655, pages 61-64.
Crossref
Ming He, Kun Lin, Youguang Huang, Licun Zhou, Qingcheng Yang, Shude Li & Weiying Jiang. (2018) Prevalence and Molecular Study of G6PD Deficiency in the Dai and Jingpo Ethnic Groups in the Dehong Prefecture of the Yunnan Province. Human Heredity 83:2, pages 55-64.
Crossref
L. C. Rizo‐de‐la‐Torre, B. Ibarra, J. Y. Sánchez‐López, M. T. Magaña‐Torres, V. M. Rentería‐López & F. J. Perea‐Díaz. (2017) Three novel HBB mutations, c.‐140C>G (‐90 C>G), c.237_256del GGACAACCTCAAGGGCACCT ( FS Cd 78/85 ‐20 bp), and c.315+2T>G ( IVS 2:2 T>G). Update of the mutational spectrum of β‐Thalassemia in Mexican mestizo patients . International Journal of Laboratory Hematology 39:5, pages 539-545.
Crossref
Jing He, Wenhui Song, Jinlong Yang, Sen Lu, Yuan Yuan, Junfu Guo, Jie Zhang, Kai Ye, Fan Yang, Fangfang Long, Zhiyu Peng, Haijing Yu, Le Cheng & Baosheng Zhu. (2017) Next-generation sequencing improves thalassemia carrier screening among premarital adults in a high prevalence population: the Dai nationality, China. Genetics in Medicine 19:9, pages 1022-1031.
Crossref
Mattapong Kulaphisit, Jatupol Kampuansai, Kamonlak Leecharoenkiat, Methi Wathikthinnakon, Daoroong Kangwanpong, Thongperm Munkongdee, Saovaros Svasti, Suthat Fucharoen, Duncan R. Smith & Pathrapol Lithanatudom. (2017) A comprehensive ethnic-based analysis of alpha thalassaemia allelle frequency in northern Thailand. Scientific Reports 7:1.
Crossref
Sheng He, Qian Qin, Shang Yi, Yuan Wei, Li Lin, Shaoke Chen, Jianping Deng, Xianmin Xu, Chenguang Zheng & Biyan Chen. (2017) Prevalence and genetic analysis of α- and β-thalassemia in Baise region, a multi-ethnic region in southern China. Gene 619, pages 71-75.
Crossref
Liusong Wu, Zhiyu Peng, Sen Lu, Mei Tan, Ying Rong, Runmei Tian, Yuhang Yang, Yan Chen & Jindong Chen. (2017) β-thalassemia caused by compound heterozygous mutations and cured by bone marrow transplantation: A case report. Molecular Medicine Reports 16:5, pages 6552-6557.
Crossref
Hongxian Liu, Kai Huang, Shuyuan Liu, Hao Sun, Keqin Lin, Xiaoqin Huang, Jiayou Chu & Zhaoqing Yang. (2016) Gene frequency and haplotype distribution of hemoglobin E among seven minority groups of Yunnan, China. American Journal of Human Biology 28:6, pages 927-931.
Crossref
Wenjun Tang, Chonglin Zhang, Fangfang Lu, Juan Tang, Yu Lu, Xiu Cui, Xue Qin & Shan Li. (2015) Spectrum of α-thalassemia and β-thalassemia mutations in the Guilin Region of southern China. Clinical Biochemistry 48:16-17, pages 1068-1072.
Crossref
Jie Zhang, Jing He, Xiao-Hong Zeng, Shi-Jun Ge, Yu Huang, Jie Su, Xue-Mei Ding, Ji-Qing Yang, Yong-Jiu Cao, Hong Chen, Ying-Hong Zhang & Bao-Sheng Zhu. (2015) Genetic Heterogeneity of the β-Globin Gene in Various Geographic Populations of Yunnan in Southwestern China. PLOS ONE 10:4, pages e0122956.
Crossref
Hongxia Yao, Xinping Chen, Lie Lin, Congming Wu, Xiangjun Fu, Hua Wang, Zhiming Yao, Wenting Chen, Li Huang, Ruimei Tang, Ruo Rao, Suwen Wang & Yipeng Ding. (2014) The spectrum of α- and β-thalassemia mutations of the Li people in Hainan Province of China. Blood Cells, Molecules, and Diseases 53:1-2, pages 16-20.
Crossref
Aihua Yin, Bing Li, Mingyong Luo, Longchang Xu, Li Wu, Liang Zhang, Yuanzhu Ma, Tingting Chen, Shuang Gao, Juqing Liang, Hao Guo, Danqing Qin, Jicheng Wang, Tenglong Yuan, Yixia Wang, Wei-wei Huang, Wen-Fei He, Yanxia Zhang, Chang Liu, Sujian Xia, Qingshan Chen, Qingguo Zhao & Xiaozhuang Zhang. (2014) The Prevalence and Molecular Spectrum of α- and β-Globin Gene Mutations in 14,332 Families of Guangdong Province, China. PLoS ONE 9:2, pages e89855.
Crossref
Sheng-Wen Huang, Xing-Mei Liu, Gui-Fang Li, Li Su, Xian Wu & Ru-Lei Wang. (2013) Spectrum of β-thalassemia mutations in Guizhou Province, PR China, including first observation of codon 121 (GAA>TAA) in Chinese population. Clinical Biochemistry 46:18, pages 1865-1868.
Crossref

Reprints and Corporate Permissions

Please note: Selecting permissions does not provide access to the full text of the article, please see our help page How do I view content?

To request a reprint or corporate permissions for this article, please click on the relevant link below:

Order Reprints Request Corporate Permissions

Academic Permissions

Please note: Selecting permissions does not provide access to the full text of the article, please see our help page How do I view content?

Obtain permissions instantly via Rightslink by clicking on the button below:

Request Academic Permissions

If you are unable to obtain permissions via Rightslink, please complete and submit this Permissions form. For more information, please visit our Permissions help page.

Related research

People also read lists articles that other readers of this article have read.

Recommended articles lists articles that we recommend and is powered by our AI driven recommendation engine.

Cited by lists all citing articles based on Crossref citations.
Articles with the Crossref icon will open in a new tab.