Publication Cover
Hemoglobin
international journal for hemoglobin research
Volume 40, 2016 - Issue 1
249
Views
8
CrossRef citations to date
0
Altmetric
Original Article

The Spectrum of β-Thalassemia Mutations in a Population from the Brazilian Amazon

, , , , , , , , & show all
Pages 20-24 | Received 19 Feb 2015, Accepted 30 Jul 2015, Published online: 15 Sep 2015

Keep up to date with the latest research on this topic with citation updates for this article.

Read on this site (2)

Prapaporn Panichchob, Pooncharus Iamdeelert, Putita Wongsariya, Pitchaya Wongsariya, Pinnaree Wongwattanasanti, Wanicha Tepakhan & Wittaya Jomoui. (2021) Molecular Spectrum of β-Thalassemia Mutations in Central to Eastern Thailand. Hemoglobin 45:2, pages 97-102.
Read now
Gisele C.S. Carrocini, Larissa P.R. Venancio, Viviani L.R. Pessoa, Clarisse L.C. Lobo & Claudia R. Bonini-Domingos. (2017) Mutational Profile of Homozygous β-Thalassemia in Rio de Janeiro, Brazil. Hemoglobin 41:1, pages 12-15.
Read now

Articles from other publishers (6)

Ekta Rao, Sandip Kumar Chandraker, Mable Misha Singh & Ravindra Kumar. (2024) Global distribution of β-thalassemia mutations: An update. Gene 896, pages 148022.
Crossref
Marcos Borato Viana, Érica Louback Oliveira & André Rolim Belisário. (2024) Severe clinical picture in a cohort of six Brazilian children with hemoglobin Sβ-thalassemia IVS-I-5 G>A. Blood Cells, Molecules, and Diseases 104, pages 102795.
Crossref
Jianlong Zhuang, Qi Luo, Shuhong Zeng, Yu’e Chen, Shuxia Lin, Yuanbai Wang & Yuying Jiang. (2022) A First Clinical and Molecular Study of Rare IVS-II-806 (G > C) (HBB:c.316-45G > C) Variant in the β-globin Gene: A Possibly Benign Variant. Indian Journal of Hematology and Blood Transfusion 39:1, pages 102-106.
Crossref
Wanicha Tepakhan & Wittaya Jomoui. (2021) Rapid molecular diagnostics of large deletional β0-thalassemia (3.5 kb and 45 kb) using colorimetric LAMP in various thalassemia genotypes. Heliyon 7:11, pages e08372.
Crossref
Madeline H. Kowalski, Huijun Qian, Ziyi Hou, Jonathan D. Rosen, Amanda L. Tapia, Yue Shan, Deepti Jain, Maria Argos, Donna K. Arnett, Christy Avery, Kathleen C. Barnes, Lewis C. Becker, Stephanie A. Bien, Joshua C. Bis, John Blangero, Eric Boerwinkle, Donald W. Bowden, Steve Buyske, Jianwen Cai, Michael H. Cho, Seung Hoan Choi, Hélène Choquet, L. Adrienne Cupples, Mary Cushman, Michelle Daya, Paul S. de Vries, Patrick T. Ellinor, Nauder Faraday, Myriam Fornage, Stacey Gabriel, Santhi K. Ganesh, Misa Graff, Namrata Gupta, Jiang He, Susan R. Heckbert, Bertha Hidalgo, Chani J. Hodonsky, Marguerite R. Irvin, Andrew D. Johnson, Eric Jorgenson, Robert Kaplan, Sharon L. R. Kardia, Tanika N. Kelly, Charles Kooperberg, Jessica A. Lasky-Su, Ruth J. F. Loos, Steven A. Lubitz, Rasika A. Mathias, Caitlin P. McHugh, Courtney Montgomery, Jee-Young Moon, Alanna C. Morrison, Nicholette D. Palmer, Nathan Pankratz, George J. Papanicolaou, Juan M. Peralta, Patricia A. Peyser, Stephen S. Rich, Jerome I. Rotter, Edwin K. Silverman, Jennifer A. Smith, Nicholas L. Smith, Kent D. Taylor, Timothy A. Thornton, Hemant K. Tiwari, Russell P. Tracy, Tao Wang, Scott T. Weiss, Lu-Chen Weng, Kerri L. Wiggins, James G. Wilson, Lisa R. Yanek, Sebastian Zöllner, Kari E. North, Paul L. Auer, Laura M. Raffield, Alexander P. Reiner & Yun Li. (2019) Use of >100,000 NHLBI Trans-Omics for Precision Medicine (TOPMed) Consortium whole genome sequences improves imputation quality and detection of rare variant associations in admixed African and Hispanic/Latino populations. PLOS Genetics 15:12, pages e1008500.
Crossref
L. C. Rizo‐de‐la‐Torre, B. Ibarra, J. Y. Sánchez‐López, M. T. Magaña‐Torres, V. M. Rentería‐López & F. J. Perea‐Díaz. (2017) Three novel HBB mutations, c.‐140C>G (‐90 C>G), c.237_256del GGACAACCTCAAGGGCACCT ( FS Cd 78/85 ‐20 bp), and c.315+2T>G ( IVS 2:2 T>G). Update of the mutational spectrum of β‐Thalassemia in Mexican mestizo patients . International Journal of Laboratory Hematology 39:5, pages 539-545.
Crossref

Reprints and Corporate Permissions

Please note: Selecting permissions does not provide access to the full text of the article, please see our help page How do I view content?

To request a reprint or corporate permissions for this article, please click on the relevant link below:

Academic Permissions

Please note: Selecting permissions does not provide access to the full text of the article, please see our help page How do I view content?

Obtain permissions instantly via Rightslink by clicking on the button below:

If you are unable to obtain permissions via Rightslink, please complete and submit this Permissions form. For more information, please visit our Permissions help page.