Prognostic value of FOXP3 and TGF-β expression in both peripheral blood and lymph nodes in patients with B-Non Hodgkin’s lymphoma

Peer review under responsibility of Alexandria University Faculty of Medicine.

Available online 24 September 2013

Figures & data

Table

Foxp3 Primers
Forward	GGCCCTTCTCCAGGACAGA
Reverse	GCTGATCATGGCTGGGTTGT
Taqman probe	5-6- FAM-ACTTCATGCATCAGCTCTCCACTGTGGAT-BHQ-1-3
GADPH primers
Forward	GCCATCAAAGAAGCCCTGAA
Reverse	GCGGGTCTGCACACATGTTA
Taqman probe	TPACATGCCTGTCACATTGAATGAAGAGGTAGAAG

Table

Foxp3 Primers
Forward	GAACCCAATGCCAACCCTAG
Reverse	TTCTTGGTTTTGAGGTCAAGG

Table 1 Clinico-pathological characteristics of B-NHL patients.

Demographic data	Healthy controls		B-NHL patients		P
Age	–		–		0.41
Range	46–60		45–60		–
Mean±SD	49.74 ± 6.2		48.38 ± 5.65		–
	No.	%	No.	%	–
Sex	–	–	–	–	–
Male	6	60	30	60	–
Female	4	40	20	40
Pathological type of B-NHL	–	–	–	–
Small follicular	–	–	30	60	–
Large diffuse	–	–	20	40
Stage
I	–	–	0	0.0	–
II	s-	–	10	20.0	–
III	–	–	24	48.0	–
IV	–	–	16	32.0	–

Table 2 Statistical comparison of hemoglobin, liver and kidney function tests in B-NHL patients before and after CHOP chemotherapy.

Laboratory investigations	B-NHL patients before treatment	B-NHL patients after treatment	Test of significance (p)
Hemoglobin (g/dL)			0.001^*
Range	9.5–12.2	10.2–13
Mean±SD	10.72 ± 0.83	11.46 ± 0.85
SGOT (U/L)			0.0109^*
Range	14–37	19–65
Mean±SD	27.71 ± 6.70	33.04 ± 9.03
SGPT (U/L)			0.002^*
Range	13–38	20–37
Mean±SD	23.63 ± 5.99	29.08 ± 5.55
Urea (mg/dL)			0.0337^*
Range	20–49	20–49
Mean±SD	32.33 ± 7.70	36.84 ± 8.83
Creatinine (mg/dL)			0.025^*
Range	0.37–1.1	0.63–1.21
Mean±SD	0.78 ± 0.23	0.89 ± 0.19
LDH (U/L)			0.042^*
Range	250–480	245–421
Mean ± SD	328.52 ± 59.768	310 ± 48.70

* P is significant if <0.05.

Figure 1 Diagrammatic illustration of serum LDH results (Units/L) of B-NHL patients before and after CHOP chemotherapy.

Table 3 TGF-β spontaneous release (pg/ml) by PBMCs.

Basal TGF-β release (pg/ml)	Healthy controls	B-NHL patients before treatment	B-NHL patients after treatment
Range	0.021–0.055	0.019–0.313	0.022–0.539
Mean ± SD	0.27 ± 0.011	0.125 ± 0.102	0.112 ± 0.114
p1	–	0.0136^*	0.032^*
p2	–	–	0.147

* P is significant if <0.05.

Figure 2 Diagrammatic representation of PHA induced TGF-β results (pg/ml).

Table 4 Statistical analysis of the results of PHA induced TGF-β release (pg/ml) by PBMCs of healthy controls as compared to B-NHL patient either before or after CHOP treatment.

PHA-induced TGF-β release (pg/ml)	Healthy controls	B-NHL patients before treatment	B-NHL patients after treatment
Range	0.018–0.611	0.020–0.388	0.031–0.584
Mean ± SD	0.259 ± 0.282	0.094 ± 0.113	0.236 ± 0.186
p1	–	0.0218^*	–
p2	–		0.547
	–		0.024^*

* P is significant if <0.05.

Figure 3 Diagrammatic representation of basal TGF-β spontaneous release (pg/ml).

Figure 4 PCR product analysis on agarose gel electrophoresis (2%). Lane (1) DNA ladder (50 bp), Lanes (2 and 3) β actin gene, Lanes (4–7): TGF-β from a L.N extract, PBMCs of a B-NHL patients after chemotherapy, a patient before chemotherapy and a healthy donor.

Table 5 mRNA expressionof TGF-β (relative index) in PBMCs from B-NHL patients.

TGF-β (relative index)	Healthy controls	B-NHL patients before CHOP therapy	B-NHL-patients after CHOP therapy
Range	0.5–2.5^*	5–25	5–15
Mean	1.33	15.33	9.67
S.D.	0.61	6.40	3.52
			–
P1	–	<0.001^*	<0.001^*
P2	–	–	<0.001^*

* P is significant if <0.05.

Figure 5 Diagrammatic representation of the results of PBMC mRNA expression of TGF-β (relative index).

Table 6 Statistical comparison of CD4+, CD25+ and CD4+/CD25+ double positive cells amonghealthy donors as compared to B-NHL patients before and after CHOP treatment.

Flow cytometric stain	Healthy controls	B-NHLpatients before treatment	B-NHL patients after treatment
CD4+ cells (%)	–	–	–
Range	21–58	20–37	26–40
Mean±SD	36.40 ± 12.84	31.20 ± 7.33	34.90 ± 4.31
Test of significance (p)	–	0.140	0.365
	–	–	0.093
CD25+ cells (%)	–	–	–
Range	11–18	13–30	15–35
Mean±SD	14.90 ± 2.28	24.80±5.07	24.40 ± 7.07
Test of significance (P)	–	0.004^*	<0.001^*
CD4/CD25double positive cells (%)	–		0.451
Range	7–14	20–35	13–19
Mean±SD	10.90 ± 2.38	25.20 ± 6.27	16.30 ± 2.06
Test of significance (P)	–	<0.001^*	<0.001^*
	–		<0.001^*

* P is significant if <0.05.

Figure 6 Flow cytometric dot plots showing two colour histogram (FSC-H/SSC-H) of PBLs from B-NHL patients.

Table 7 Statistical comparison between the expression of Foxp3 (relative index) in RNA extracts of PBMCs from B-NHL patients (either before or after treatment) as compared to their corresponding healthy controls.

Foxp3 (relative index)	Healthy controls	B-NHL patients before treatment	B-NHL Patients after treatment
Range	0.8–1.19	1.08–1.21	0.6–1.19
Mean	1.05	1.13	1.04
SD	0.12	0.04	0.16
Test of significance (P)	–	0.030^*	0.419
	–	–	0.05^*

* P is significant if <0.05.

Table 8 Statistical analysis of intratumoral mRNA expression of Foxp3 and TGF-β (relative index) distributed according to patient‘s age, sex, gender and serum LDH level.

Parameter	Foxp3 (mean ± SD)	Test of significance (p)	TGF-β (mean ± SD)	Test of significance (p)
Patient’s age
>50 years	1.20 ± 0.04	0.001^*	16.54 ± 5.91	0.196
<50 years	1.15 ± 0.04		14.17 ± 7.64
Patient’s sex
Male	1.18 ± 0.04	0.03^*	16.818 ± 6.809	0.18
Female	1.13 ± 0.04		14.286 ± 6.753
Serum LDH
>460	1.161 ± 0.05	0.03^*	16.818 ± 6.809	0.18
<460	1.155 ± 0.05		14.286 ± 6.753
Pathological type	1.17 ± 0.04	0.0039^*	17.50 ± 7.91	0.238
Follicular diffuse	1.13 ± 0.04		15.33 ± 6.94

* P is significant if <0.05.

Figure 7 Kaplan Mayer curve for over all survival of B-NHL.

Figure 8 Kaplan Mayer curve for progression free survival.

Table 9 Distribution of the studied patients regarding the outcome.

Response	No. of the patients	Percent
Complete response	40	80.0%
Partial response	10	20.0%

Table 10 Overall survival of B-NHL patients all over the period of follow up.

Duration /Month	No. of the patients	%
At base line	50	100.0
6 months	48	96.0
12 months	46	92.0
18 months	44	88.0
24 months	42	84.0

Table 11 Progression free survival of the studied patients all over the period of follow up.

Duration/month	No.	%
At base line	50	100.0
6 months	36	72.0
12 months	24	48.0
18 months	22	44.0
24 months	20	40.0

Table 12 Relation between response and over all survive in relation to both Foxp3 and TGF-β.

	Response				P	Over all survive				p
	Complete “n = 40”		Partial “n = 10”			Survive “n = 42”		Die “n = 8”
	No.	%	No.	%		No.	%	No.	%
TGF-B (pg/ml)					0.032^∗					0.0422^∗
<15 (n = 32)	31	96.9	1	3.1		29	90.6	3	9.4
>15 (n = 18)	9	50.0	9	50.0		13	72.2	5	27.8
Foxp3(relative expression)
<1.1 (n = 21)	19	90.5	2	9.5	0.041^∗	17	81.0	4	19.0	0.322
>1.1 (n = 29)	21	72.4	8	27.6		25	86.2	4	13.8

Table 13 Correlation study of different parameters.

Parameter		LDH	Foxp3	CD4	CD25	DP	TGF-B	Performance status
Foxp3	Pearson Correlation	.233
	p	.104
CD4+	Pearson Correlation	−.347^*	−.706^**
	p	.014	.000
CD25+	Pearson Correlation	−.009	−.619^**	.446^**
	p	.950	.000	.000
CD4/CD25DP	Pearson Correlation	.494^*	.319^*	−.443^**	.267^*
	p	.000	.013	.000	.039
TGF-β	Pearson Correlation	−.180	−.130	−.022	.235	.509^**
	p	.341	.423	.893	.145	.001
Performa-nce status	Pearson Correlation	0.382^*	0.398^*	0.107	0.201	0.207	0.103
	p	0.016	0.01	0.336	0.165	0.177	0.336
Stage	Pearson Correlation	0.425^*	0.356^*	0.252^*	0.301^*	0.485^*	0.446^**	0.369^*
		0.001	0.004	0.048	0.036	0.001	0.001	0.021

* P is significant if <0.05.