Retinoic acid improves maturation rate and upregulates the expression of antioxidant-related genes in in vitro matured buffalo (Bubalus bubalis) oocytes

Peer review under responsibility of Faculty of Veterinary Medicine, Cairo University.

Figures & data

able 1 Details of primers used for quantitative real-time PCR.

Gene	Accession number	Primer sequences	Product size (bp)
SOD1	XM_006053564	F: gagaggcatgttggagacct R: ctgcccaagtcatctggtt	153
GPX4	XM_006050496	F: agccagggagtaatgcagag R: cacacagccgttcttgtcaa	203
CAT	XM_006062382	F: agatggacacaggcacatga R: attgaaaagatcgcggaggc	184
PRDX1	XM_006052557	F: aaacaaggaggactgggacc R: gcacacttccccatgtttgt	243
HMOX1	XM_006074428	F: atgccccaggatttgtcaga R: aggggagtatagacggggtt	206
GAPDH	XM_006065800	F: agatggtgaaggtcggagtg R: tggaagatggtgatggcctt	229

ig. 1 Cleavage rates per total fertilized oocytes after maturation in vitro with a supplementation of 0 (control), 5, and 50 nM of 9-cisRA.

able 2 Expansion and polar body appearance rates under different concentrations (0, 5, 50 and 200 nM) of 9-cisRA during in vitro maturation of buffalo oocytes.

Groups	Total oocyte	Expanded oocytes (% ± S.D)	Polar body appearance (% ± S.D)
Control	115	86.7 ± 5.4^b	29.7 ± 1^b
9-cisRA5	115	95.8 ± 5^a	45.5 ± 5.2^a
9-cisRA50	115	80.5 ± 1.8^c	26.4 ± 5^c
9-cisRA200	115	79.1 ± 3^c	23.6 ± 5^c

^{a, b, c} values with different letters in the same column are significantly different (P < .05).

ig. 2 (A) Mitochondrial membrane potential activity (MitoTracker1-Red stain) of buffalo oocytes matured in vitro with a supplementation of (a) 0 (control), (b) 5, (c) 50 and (d) 200 nM of 9-cisRA. Scale bar, 100 μm. (B) Total corrected fluorescence (TCF) levels of oocytes from different groups. ^{a, b, c} values with different letters are significantly different (P < .05).

ig. 3 (A) ROS levels (H2DCFDA stain) in buffalo oocytes matured in vitro with supplementation of (a) 0 (control), (b) 5, (c) 50 and (d) 200 nM of 9-cisRA. Scale bar, 100 μm. (B) Total corrected fluorescence (TCF) levels of oocytes from different groups. ^{a, b, c} values with different letters are significantly different (P < .05).

ig. 4 Relative expression of antioxidant-related genes (SOD1, CAT, HOMX1, PRDX1, and GPX4) represented as fold change (FC) in buffalo oocytes matured in vitro with supplementation of 0 (control), 5, 50 and 200 nM of 9-cisRA. ^a,b,c values with different letters are significantly different (P < .05).