Additional molecular testing of saliva specimens improves the detection of respiratory viruses

Figures & data

Figure 1 Study design. nasopharyngeal aspirate, NPA; quantitative PCR with reverse transcription, qRT-PCR. ^aRoutine clinical testing was performed using antigen detection by the DFA, which included the influenza A and B viruses, parainfluenza virus types 1–3, respiratory syncytial virus, human metapneumovirus and adenovirus. From 1 March to 8 April 2015 (during the peak influenza A virus season), monoplex real-time RT-PCR for the influenza A M gene was performed for patients admitted to the general medical ward. ^bPatients whose NPA specimens either tested negative for respiratory viruses by DFA or had insufficient NPCs for DFA during routine clinical testing. Insufficient NPCs is defined as <20 NPCs in the entire well.

Table 1 Primers and probes used in the quantitative reverse transcription PCR

Virus	Primer/probe sequence (5′-3′)
Influenza A virus	Forward	GACCRATCCTGTCACCTCTGAC
	Reverse	AGGGCATTYTGGACAAAKCGTCTA
	Probe	FAM- TGCAGTCCTCGCTCACTGGGCACG -BHQ1
Influenza B virus	Forward	ACAATTGCCTACYTGCTTTCA
	Reverse	TCTTTCCCACCRAACCAAC
	Probe	HEX- AGAAGATGGAGAARGCAAAGCAGAACTAGC -IABkFQ
Human metapneumovirus	Forward	CATAYAARCATGCTATATTRAAAGAGTCTC
	Reverse	CCTATYTCWGCAGCATATTTGTAATCAG
	Probe	FAM- CAACHGCAGTRACACCYTCATCATTRCA -IABkFQ
Respiratory syncytial virus	Forward	CTTAGCAAAGTCAAGTTRAATGATACA
	Reverse	TGCACATCATAATTRGGAGTGTC
	Probe	HEX- ACYATYCAACGKAGYACAGGAGA -IABkFQ
Parainfluenza virus type 1	Forward	GGAGGAGCAATTATACCTGGTCA
	Reverse	TGTATCCARTGAGTGGGCTA
	Probe	LC610- ATTAGGCCCGAGTGTRACRGATGATGC -BBQ
Parainfluenza virus type 2	Forward	TATGCYATGGTGGGAGACATT
	Reverse	GCCATCTTGTTCCAAGTCCAT
	Probe	FAM- CCTCCCATTCCGCTGTGTTCAATRTACTT -IABkFQ
Parainfluenza virus type 3	Forward	AGCTATYACTAGYATCTCAGGGT
	Reverse	CCCAATCTGATCCACTGTGT
	Probe	HEX- TCAGACAAGATGGAACAGTGCAGGCA -IABkFQ

Figure 2 Viral loads in the NPA and the saliva specimens for all patients in the first cohort. The number of patients infected with each of the respiratory viruses is outlined in Table 2. (A) Comparison of viral loads between the NPA and saliva specimens. (B) Comparison of the saliva viral load of influenza A and influenza B in patients with saliva collected before and after oseltamivir treatment. (C) Comparison of the saliva viral loads in patients with or without pneumonia. Medians, quartiles, and ranges are shown. nasopharyngeal aspirate, NPA.

Table 2 Detection of viruses using quantitative real-time reverse transcription PCR in the first cohort of patients

Virus	Number of patients with the virus detected in the NPA during routine clinical testing^a	Saliva-positive, number (%)	Higher viral load in saliva than in NPA, number (%)
Influenza A virus	99^b,^c	95 (96.0)	17 (17.2)
Respiratory syncytial virus	18	15 (83.3)	1 (5.6)
Human metapneumovirus	14	11 (78.6)	2 (14.3)
Influenza B virus	12	10 (83.3)	3 (25)
Parainfluenza virus type 3	8	8 (100)	2 (25.0)
Parainfluenza virus type 1	5	4 (80)	1 (20.0)
Parainfluenza virus type 2	3	3 (100)	1 (33.3)
All viruses	159	146 (91.8)	27 (17.0)^d

Abbreviations: direct immunofluorescence, DFA; nasopharyngeal aspirate, NPA; PCR with reverse transcription, RT-PCR.

^aRoutine clinical testing was performed using antigen detection by DFA, which included influenza A and B viruses, parainfluenza virus types 1–3, respiratory syncytial virus, human metapneumovirus and adenovirus. From 1 March to 8 April 2015 (during the peak season of influenza A virus), monoplex real-time RT-PCR for influenza A M gene was performed for patients admitted to the general medical ward. Among patients recruited in this study, there were no patients with adenovirus detected in their NPA during routine clinical testing.

^bEighty-four patients were infected with H3 subtype, while 15 patients were infected with H1 subtype.

^cEighty-seven patients (87.9%) were tested positive for influenza A virus using antigen detection by direct immunofluorescence. Twelve patients (12.1%; all infected with H3 subtype) admitted to the general medical ward during the peak influenza season were tested by RT-PCR for influenza virus M gene only during the routine clinical testing.

^dThe denominator includes those patients for whom their saliva specimens were tested negative for respiratory viruses. This is because these patients may have a low quantity of respiratory virus present in their saliva specimens but below the detection limit of the assay.

Table 3 Detection of respiratory viruses in nasopharyngeal aspirate and saliva using NxTAG Respiratory Pathogen Panel in the second cohort of patients^a

	All NPA (n=99)	NPA with sufficient nasopharyngeal epithelial cells (n=80) Number (%) of patients
Number of patients with ≥1 respiratory virus detected
NPA or saliva	22 (22.2)	17 (21.3)
NPA	14 (14.1)	12 (15.0)
Saliva	16 (16.2)	12 (15.0)
Concordant
Same respiratory virus detected in both NPA and saliva	6 (6.1)	5 (6.3)
No respiratory viruses detected in NPA or saliva	77 (77.8)	63 (78.8)
Total	83 (83.8)	68 (85.0)
Discordant
Additional respiratory virus detected in saliva	9 (9.1)^b	6 (7.5)
Additional respiratory virus detected in NPA	7 (7.1)^c	6 (7.5)
Total	16 (16.2)	12 (15.0)

Abbreviation: nasopharyngeal aspirate, NPA.

^aRespiratory viruses detected by NxTAG Respiratory Pathogen Panel include influenza A virus, influenza B virus, respiratory syncytial viruses A and B, enterovirus/rhinovirus, parainfluenza viruses 1-4, human metapneumovirus, adenovirus, coronaviruses HKU1, NL63, 229E and OC43, and human bocavirus.

^bFor eight patients, respiratory virus was not detected in the NPA by multiplex PCR. For one patient (patient 4 in Table 5), enterovirus/rhinovirus was detected in both NPA and saliva, but human metapneumovirus was detected in saliva only.

^cFor six patients, respiratory virus was not detected in saliva. For one patient, human metapneumovirus and respiratory syncytial virus A was detected in both NPA and saliva, but coronavirus 229E was detected in NPA only.

Table 4 Respiratory viruses detected using multiplex PCR panel in the second cohort of patients^a

Respiratory virus	Number of patients
	Total^b	NPA and saliva	NPA only	Saliva only
Human metapneumovirus	9	3	3	3
Rhinovirus/enterovirus	4	1	1	2
Influenza A	5	1	1	3
Influenza B	2	2	0	0
Respiratory syncytial virus	2	2	0	0
Coronavirus OC43	1	0	0	1
Coronavirus 229E	1	0	1	0
Adenovirus	1	0	1	0
Total	25	9	7	9

Abbreviation: nasopharyngeal aspirate, NPA.

^aMultiplex PCR was performed using NxTAG Respiratory Pathogen Panel, which included influenza A and B, influenza A H1, influenza A H3, respiratory syncytial viruses A and B, respiratory syncytial virus B, parainfluenza viruses 1-4, human bocavirus, human metapneumovirus, rhinovirus/enterovirus, adenovirus, coronavirus (HKU1, NL63, OC43 and 229E), Chlamydophila pneumoniae and Mycoplasma pneumoniae. The atypical bacterial pathogens C. pneumoniae and M. pneumoniae were excluded from the analysis.

^bTwo patients had more than one respiratory virus detected (one patient with human metapneumovirus and enterovirus/rhinovirus; 1 patient with human metapneumovirus, respiratory syncytial virus A and coronavirus 229E).

Table 5 Nine patients with additional respiratory viruses detected only in their saliva for the second cohort of patients

Case Number	Sex/age in years	Underlying medical conditions	Presenting symptom; final diagnosis	Respiratory virus detected in NPA^a	Additional virus detected in saliva^a	Potential changes in antiviral treatment or infection control practice
1	M/56	Nasopharyngeal carcinoma	Productive cough, dyspnea; pneumonia	Negative^b	Influenza A H1	Neuraminidase inhibitor
2	F/78	Gout	Fever, dyspnea; lower respiratory tract infection	Negative^b	Influenza A H3	Neuraminidase inhibitor
3	M/81	DM, Ca prostate	Productive cough; upper respiratory tract infection	Negative^c	Influenza A H3	Neuraminidase inhibitor
4	F/81	Hypertension, hyperlipidemia, IFG	Rhinorrhea, cough, dyspnea, wheeze; pneumonia	EV/RV^b	hMPV	Contact precaution
5	M/72	DM, hypertension	Fever, rhinorrhea, dry cough; pneumonia	Negative^b	hMPV	Contact precaution
6	M/55	Schizophrenia, gout, CVA	Fever, productive cough; pneumonia	Negative^c	hMPV	Contact precaution
7	M/63	Asthma, Churg-Strauss syndrome	Productive cough, dyspnea; asthmatic attack	Negative^b	EV/RV	Nil
8	F/63	Stage IV lymphoma, hypertension, asthma	Fever, productive cough, chills; upper respiratory tract infection	Negative^b	EV/RV	Nil
9	M/79	Ischemic heart disease, diabetic nephropathy, Ca prostate with bone metastasis, pemphigoid, bronchiectasis	Fever and dizziness; CAPD peritonitis	Negative^c	Coronavirus OC43	Nil

Abbreviations: carcinoma, Ca; continuous ambulatory peritoneal dialysis, CAPD; cerebrovascular accident, CVA; diabetes mellitus, DM; enterovirus/rhinovirus, EV/RV; human metapneumovirus, hMPV; impaired fasting glucose, IFG.

^aRespiratory virus detection was performed using NxTAG Respiratory Pathogen Panel.

^bSufficient nasopharyngeal columnar epithelial cells detected during DFA.

^cInsufficient nasopharyngeal columnar epithelial cells detected during DFA.