Ranavirus genotypes in the Netherlands and their potential association with virulence in water frogs (Pelophylax spp.)

Figures & data

Fig. 1 Genome layouts of three main CMTV-NL groups.

A representative layout of group I viruses is featured in the middle section to facilitate comparison to CMTV NL II (left) and III (right). Red arrows represent shortened ORFs with the white portion of the arrows representing the amount of lost nucleotides/amino acids. Blue arrows represent genes with ORFs larger than their counterparts in CMTV-NL group I. Black arrows represent core iridoviral proteins. Green arrows represent genes identical in all groups

Fig. 2 Ranavirus phylogenetic tree based on 50 genes (1000 bootstrap values).

All Dutch ranaviruses cluster within the CMTV-like clade. Group II and III cluster closely with CMTV-like ranaviruses from China (ADRV, CGSIV), Italy (REV), Switzerland (THR), and Denmark (PEV-DEK1). Isolates and Genbank numbers used: common midwife toad ranavirus isolate Pelophylax kl.esculentus/2013/NL (KP056312), common midwife toad ranavirus isolate Mesotriton alpestris/2008/E (JQ231222), Rana esculenta virus isolate REV 282/I02 (MF538628), Pelophylax esculentus virus isolate PEV_DK1 (MF538627), Rana catesbeiana virus 1 isolate RCV-Z (MF187210), R. catesbeiana virus 2 isolate RCV2-Z2 (MF187209), Frog virus 3 (AY548484), Frog virus 3 isolate SSME (KJ175144), tortoise ranavirus isolate 1 (882/96) (KP266743), Testudo hermanni ranavirus isolate CH8/96 (KP266741), German gecko ranavirus isolate 2000/99 (KP266742), tiger frog virus (AF389451), soft shelled turtle iridovirus (EU627010), European sheathfish virus (JQ724856), Epizootic hematopoietic necrosis virus (FJ433873), Ambystoma tigrinum stebbensi virus (AY150217), Andrias davidianus ranavirus isolate 1201 (KC865735), Chinese giant salamander iridovirus, isolate CGSIV-HN1104, (KF512820), Rana grylio ranavirus (JQ654586), pike perch iridovirus isolate SLU 144001 (KX574341), Bohle iridovirus isolate BIV-ME 93/95, cod iridovirus isolate GAM14001 (KX57432), ranavirus maximus isolate SMA15001 (N_C030842), and short-finned eel ranavirus isolate ANGA14001 (KX353311)

Comparison of individual genes between CMTV-NL groups I, II, and III

Gene	Predicted function	NL-I	NL-II	NL-II Mutations/Locations	NL-III	NL-III Mutations/locations
2L	Myristolated membrane protein	361 aa	330 aa	c.1706_1744del, c.1719_177del, c.1853_1867del	325 aa	c.1706_1744del, c.1719_177del, c.1853_1867del
11L	Hypothetical protein	84 aa	66 aa	c.15506_15507delGA, 15593delA	76 aa	c.15593delA
20R	Hypothetical protein	71 aa	61 aa	c.25253_25282del	61 aa	c.25253_25282del
35R	Hypothetical protein	238 aa	238 aa	NA	65 aa	c.39165 G > T Stop codon
41R	Hypothetical protein	120 aa	117 aa	c.43380delC	120 aa	NA
42R	Hypothetical protein	114 aa	32 aa	32	114 aa	NA
49L	Hypothetical protein	248 aa	184 aa	c.55171delT	184 aa	c.55171delT
54L	Hypothetical protein	369 aa	369 aa	NA	229 aa	c.58251 G > A
59R	Hypothetical protein	562 aa	478 aa	c.64875_64922del,c.65051_65052del	487 aa	c.64091–64931del
66L	Hypothetical protein	46 aa	54 aa	54	46 aa	NA
70L	Putative NIF/NLI interacting factor	211 aa	209 aa	c.76602_76607del	211 aa	NA
73R	Hypothetical protein	155 aa	66 aa	c.78357_78350delCC premature stop codon	155 aa	NA
82L	p31K	305 aa	403 aa	c.89023_89024dupA	262 aa	c.89033dupA
85L	Putative D5 family NTPase/ATPase	975 aa	965 aa	c.94968_94997del	975 aa	NA
92R	Hypothetical protein	315 aa	27 aa	c.100970dupC premature stop codon	311 aa	c.101099_101110del
93L	Putative integrase like protein	275 aa	275 aa	NA	17 aa	c.101925delT premature stop codon
102R	Myeloid cell leukemia protein	145 aa	141 aa	c.107277_107289del	141 aa	c.107277_107289del

NA Not applicable as no mutations resulting in a decreased number of aminoacids occurred in comparison to CMTV-NL group I

Analysis of ranavirus repetitive regions

Gene	Sequence	Isolate no.	Year of collection	NL-strain	No. repeats for fully sequenced viruses	No. repeats for additional virus sequences from same site
17L	AGCAACGCCCTGCTCAGCAGC	1	2011	I	7	NA
		2	2011	I	10	NA
		3	2011	I	11	NA
		4a^a, 4b^b	2012, 2015	I	13 (4a^a,4b^b)	11 (2/5^a), 13 (3/5^a)
		5^b	2014	I	11	NA
		6a, 6b	2013, 2014	I	7 (6a, 6b)	NA
		7a, 7b	2014, 2015	I	10 (7a, 7b)	10 (2/2; 3/3^b)
		8	2015	I	7	7 (5/5)
		9	2015	II	7	NA
		10	2016	III	7	7 (5/5)
62R	AAGAGATCACCAGTGAAG	1	2011	I	17	NA
		2	2011	I	15	NA
		3	2011	I	13	NA
		4a^a, 4b^b	2012, 2015	I	9 (4a^a), 5 (4b^b)	8 (1/5), 7 (1/5), 6 (3/5)
		5^b	2014	I	11	NA
		6a, 6b	2013, 2014	I	6 (6a), 13 (6b)	NA
		7a, 7b	2014, 2015	I	6 (7a), 14 (7b)	19 (1/5), 15 (3/5), 14 (1/5)
		8	2015	I	12	12 (5/5)
		9	2015	II	6	NA
	AAGAGCTCACCCGTGAAG	10	2016	III	4	8 (4/5), 10 (1/5)
67L	CCACTCAGAGTCCTACCA	1	2011	I	10	NA
		2	2011	I	9	NA
		3	2011	I	9	NA
		4a^a, 4b^b	2012, 2015	I	7 (4a^a), 6 (4b^b)	13 (1/5), 10 (2/5), 7 (1/5), 6 (1/5)
		5^b	2014	I	8	NA
		6a, 6b	2013, 2014	I	9 (6a,6b)	NA
		7a, 7b	2014, 2015	I	11 (7a,7b)	11 (3/5),10 (1/5), 9 (1/5)
		8	2015	I	9	9 (5/5)
		9	2015	II	4	NA
		10	2016	III	2	2 (5/5)

^aPelobates fuscus

^bLissotriton vulgaris

Other species were all Pelophylax

Fig. 3 Multi-step growth curve assay.

The figure depicts the average titer of each virus group and time point from three independent experiments. Error bars represent standard deviation

Fig. 4 Proportion of ranavirus in swabbed specimens and adult water frog abundance (a, b) Ranavirus was detected from swabs and percentage of positive animals at each site is given. Water samples positive for ranavirus are indicated by blocks matching the color of the waterbody; (c, d) The ratio of water frog per shore meter is depicted for each visit for all waterbodies. No water frogs could be found for swabbing at DNP-I in visits June 15, June 29, July 13, July 28, and August 24, or in DNP-II from visit July 28 onwards

Fig. 5 Histopathology and immunohistochemistry of ranavirus-infected water frogs.

Top panel: (left) Hematoxylin/Eosin staining of a liver section from an affected water frog adult from DNP with intracytoplasmic basophilic inclusions (black arrows) and (right) immunohistochemical staining of a serial section in which intracytoplasmic inclusions present with marked immunolabelling confirming active viral replication. Lower panel: (left) hematoxylin/eosin staining of forelimb from affected water frog larva with no apparent microscopic lesion; (right) immunohistochemical staining of a serial section, in which positive immunolabelling is present in the periarticular muscle and connective tissue