Replication of MERS and SARS coronaviruses in bat cells offers insights to their ancestral origins

Figures & data

Fig. 1 The twelve bat cell lines and Vero cells were subject to infection by MERS-CoV in clade A and clade B.

The 12 bat cell lines (PAK: Pipistrellus abramus kidney, PAL Pipistrellus abramus lung, RSK: Rhinolophus sinicus kidney, RSL: Rhinolophus sinicus lung, MRK: Myotis ricketti kidney, MRL: Myotis ricketti lung, TPK: Tylonycteris pachypus kidney, TPL: Tylonycteris pachypus lung, HPK: Hipposideros pomona kidney, RLK: Rousettus leschenaultii kidney, RLL: Rousettus leschenaultii lung, MPK: Miniopterus pusillus kidney) and Vero cells were subject to infection by MERS-CoV EMC/2012 (belonging to clade A1) with MOI of 1 (a). Culture supernatants were harvested at day 0 and 5 postinfection. Viral titers were determined by real-time quantitative RT-PCR. Viral load was expressed as log₁₀ copies/mL. Error bars indicate the standard deviation of triplicate samples. The five bat cell lines susceptible to MERS-CoV EMC/2012 infection with ≥ 1 log₁₀ increase in viral load at day 5 were marked with red triangles. They were subject to infection by three other MERS-CoV strains isolated from camels in Dubai, D998/15 (belonging to clade A2) (b), D1189.1/15 (c) and D1271.1/15 (d) (belonging to clade B3) (b). Different MERS-CoV strains displayed different infectivities in these five bat cells. (*P < 0.05; **P < 0.01; ***P < 0.001)

Fig. 2 Cytopathic effects (CPE) were observed in infected M. ricketti lung, R. sinicus lung and Vero cells on 5 days postinfection.

CPE was compared between Myotis ricketti lung (immortalized) cells that were uninfected (control) (a), and infected with Dubai camel MERS strains D998/15 (b), D1189.1/15 (c) & D1271.1/15 (d). CPE was compared between Rhinolophus sinicus lung (immortalized) cells that were uninfected (control) (e), and infected with Dubai camel MERS strains D998/15 (f), D1189.1/15 (g), and D1271.1/15 (h). CPE was compared between Vero cells that were uninfected (control) (i), and infected with Dubai camel MERS strains D998/15 (g), D1189.1/15 (k), and D1271.1/15 (l)

Fig. 3 The twelve bat cell lines and Vero/HFL cells were subject to infection by SARS-CoV and HCoV-229E.

The 12 bat cell lines (PAK: Pipistrellus abramus kidney, PAL Pipistrellus abramus lung, RSK: Rhinolophus sinicus kidney, RSL: Rhinolophus sinicus lung, MRK: Myotis ricketti kidney, MRL: Myotis ricketti lung, TPK: Tylonycteris pachypus kidney, TPL: Tylonycteris pachypus lung, HPK: Hipposideros pomona kidney, RLK: Rousettus leschenaultii kidney, RLL: Rousettus leschenaultii lung, MPK: Miniopterus pusillus kidney) and Vero/HFL cells were subject to infection by SARS-CoV with MOI of 1 (a) and HCoV-229E with MOI of 0.01(b). Culture supernatants were harvested at day 0 and 5 postinfection. Viral titers were determined by real-time quantitative RT-PCR. Viral load was expressed as log₁₀ copies/mL. Error bars indicate the standard deviation of triplicate samples. Only RSK cells can support SARS-CoV infection with ≥ 1 log₁₀ increase in viral load at day 5 (blue triangle) and none of the 12 bat cell lines support HCoV-229E infection. (*P < 0.05; **P < 0.01; ***P < 0.001)

Fig. 4 Phylogenetic analyses of partial DPP4 mRNA sequences and comparison of critical amino acid residues of human, camels, bats and other animals.

(a) The trees were constructed by Neighbor-Joining method using JTT substitution models and bootstrap values calculated from 1000 trees. Only bootstrap values >70% are shown. One hundred and twelve aa positions were included in the analyses. The scale bars represent 20 substitutions per site. Bat DPP4s that are sequenced in this study are labeled with black circles. Comparison of critical amino acid residues in DPP4 from different animal host for receptor binding in the region of residues 229–346 with respect to human DPP4 (b)

Fig. 5 DPP4 expression analysis of bat cell lines.

(a) mRNA levels of DPP4 were measured in various bat cells extracts by RT-qPCR and plotted relative to Vero cells, normalized by β-actin mRNA levels. The mRNA levels of DPP4 were compared between susceptible and non-susceptible bat cell lines (b). Statistical significance was assessed by Student’s t test P < 0.05

Fig. 6 Infection assay of T. pachypus lung and kidney cells with tpDPP4 overexpression.

Cells were infected with MERS-CoV at a multiplicity of infection (MOI) of 1 for 5 days. Determination of MERS-CoV viral load in supernatant (n = 3) by RT-qPCR with normalization to β-actin (represented by bar). Determination of tpDPP4 expression in cell lysates (n = 3) by RT-qPCR with normalization to beta-actin (represented by dot). (*P < 0.05, **P < 0.01, ***P < 0.001)

Cell lines used in the present study

Organism		Site of origin	Source
Bat	Hipposideros pomona (Pomona roundleaf bat)	Kidney	In-house development
	Miniopterus pusillus (Lesser bent-winged bat)	Kidney	In-house development
	Myotis ricketti (Rickett’s big-footed bat)	Kidney	In-house development
	Myotis ricketti (Rickett’s big-footed bat)	Lung	In-house development
	Pipistrellus abramus (Japanese pipistrelle)	Kidney	In-house development
	Pipistrellus abramus (Japanese pipistrelle)	Lung	In-house development
	Rhinolophus sinicus (Chinese horseshoe bat)	Kidney	In-house development
	Rhinolophus sinicus (Chinese horseshoe bat)	Lung	In-house development
	Tylonycteris pachypus (Lesser bamboo bat)	Kidney	In-house development
	Tylonycteris pachypus (Lesser bamboo bat)	Lung	In-house development
	Rousettus leschenaultii (Leschenault’s rousette)	Kidney	In-house development
	Rousettus leschenaultii (Leschenault’s rousette)	Lung	In-house development
Human	Homo sapiens	Embryonic Lung	HFL (In-house development)
Monkey	Cercopithecus aethiops (African green monkey)	Kidney	Vero (ATCC CCL-81)

Primers used for RT-qPCR in this study

Target	Primers
	Forward	Reverse	Probe
MERS-CoV N gene	5′-CAAAACCTTCCCTAAGAAGGAAAAG -3′	5′-GCTCCTTTGGAGGTTCAGACAT-3′	(5′-(FAM)ACAAAAGGCACCAAAAGAAGAATCAACAGACC(BHQ1)-3′
SARS-CoV N gene	5′- ACCAGAATGGAGGACGCAATG-3′	5’-GCTGTGAACCAAGACGCAGTATTAT-3′	5′-(FAM)ACCCCAAGGTTTACCC(NFQ)-3′
HCoV-229E N gene	5′-CAGTCAAATGGGCTGATGCA-3′	5’-AAAGGGCTATAAAGAGAATAAGGTATTCT-3’	5’-(FAM)CCCTGACGACCACGTTGTGGTTCA(BHQ1)-3′
DPP4	5′-TGATCTTGCCTCCTCATTTTGATAA-3′	5’-GTAACCACTTCCTCTGCCATCAA-3’ or 5’-GTAACCACTTCCTCTGCCGTCAA-3’ (for Rousettus cell lines)	5’-(FAM)CCACMTTCAMACTCARYTGGGCTACTTACC(BHQ1)-3′
β-actin	5′-CTCTTCCAGCCCTCCTTCCT-3′	5′-TTCATCGTGCTGGGAGCC-3′ or 5′-TTCATTGTGCTGGGAGCC-3’ (for Rousettus cell lines) or 5′-TTCATGGTGCTGGGGGCC-3′ (for Rhinolophus cell lines)	5’-(FAM)CATGAAGTGYGACGTBGACATCCG(BHQ1)-3′