Air-classified faba bean protein fraction as a substitute to soybean meal in pelleted and extruded broiler diets

Figures & data

Table 1. Analysed chemical composition (g/kg) of dehulled faba beans (FB), faba bean protein fraction (FBP) and soybean meal (SBM)

Item	FB	FBP	SBM
Dry matter	860	925	873
Crude protein	276	585	454
Starch	309	81	23
Fat	17.5	31	12.4
NDF	48.6	91	127
P		1.25	7.5
Ca		1	3.4

Table 2. Analysed amino acid* composition (g/kg DM)

Protein ingredients^1	SBM	FBP
Essential amino acids
Arginine	33.4	47.8
Histidine	11.9	13.7
Isoleucine	21.1	19.8
Leucine	34.8	37.5
Lysine	28.2	34.2
Methionine	6.4	3.8
Phenylalanine	24.4	21.7
Threonine	17.8	18.1
Valine	20.8	23.1
Non-essential amino acids
Alanine	18.3	18.5
Aspartic acid	52.6	56.5
Cysteine	6.8	5.9
Glutamic acid	82.9	88.3
Glycine	17.1	18.7
Proline	22.5	22.3
Serine	23.4	23.9
Tyrosine	17.0	13.6
Total amino acid	439.3	467.5

¹SBM: soybean meal; FBP: faba bean protein fraction

*Determined using water-corrected molecular weights

Table 3. Experimental diet composition, analysed and calculated nutrient content

Ingredients, g/kg (as fed)	SBM-based	FBP-based
Wheat	582	589
Faba bean protein (FBP)	–	197.6
Soybean meal (SBM)^1	274	–
Cellulose powder ^2	–	58
Rapeseed oil	75	76
Limestone	14.8	16.3
Monocalcium phosphate	16.8	19.0
L-Lysine HCl	8.0	10.4
DL-Methionine	6.1	7.5
L-Threonine	4.0	7.6
Sodium chloride	4.7	4.0
Titanium dioxide	5	5
Choline chloride	1.97	1.97
Mineral & Vitamin premix ^3	6.13	6.13
Enzyme (Rovabio) ^4	1.5	1.5
Analysis	Pelleted – Extruded	Pelleted – Extruded
Dry matter (g/kg)	904–934	916–963
Gross energy (MJ/kg DM)	19.76	19.81
Starch (g/kg DM)	370	374
Crude Protein (g/kg DM)	239	230
Ether extract (g/kg DM)	90	100
NDF (g/kg DM)	110	120
Calculated nutrient content^5
Metabolisable energy (MJ/kg)	12.71	12.74
Calcium (g/kg)	9.7	9.9
Available Phosphorous (g/kg)	5.0	5.1

¹Ground to pass through a 1-mm screen

²SANACEL® 150, CFF GmbH & Co. KG, Gehren. Germany.

³Mineral and vitamin premix provided the following per kg diet: Fe, 50 mg; Mn, 122 mg; Zn, 80 mg; Cu, 14 mg; I, 0 · 72 mg; Se, 0 · 28 mg, retinyl acetate, 5.72 mg; cholecalciferol, 0.15 mg; dl-α-tocopherol acetate, 78 mg; menadione, 8 mg; thiamine, 5 mg; riboflavin, 24 mg; niacin, 32 mg; calcium pantothenate, 24 mg; pyridoxine, 13 mg; cobalamin, 0.03 mg; biotin, 0.5 mg; folic acid, 4 mg.

⁴Enzyme Rovabio Excel Ap T-Flex, Adisseo, France provided the following per kg diet: Endo-1,4-β-xylanase: 33 000 visco units; Endo-1,3(4)-β-glucanase: 45 000 visco units; Endo-1,4-β-glucanase (cellulase) >9600 DNS units + 16 other enzyme activities obtained from a fermentation broth of Penicillium funiculosum.

⁵ME was calculated using the European Community equation and available Phosphorous was calculated by subtracting phytate phosphorus in wheat, soybean meal and faba bean white flower from total phosphorus values (SAUVANT et al. 2004).

Table 4. Analysed amino acid*composition (g/kg DM) of the diets

Diets	SBM-based	FBP-based
Essential amino acids
Arginine	12.5	12.8
Histidine	4.6	4.2
Isoleucine	7.6	6.4
Leucine	13.7	13.0
Lysine	16.3	17.6
Methionine	7.8	7.8
Phenylalanine	9.2	7.8
Threonine	9.6	11.1
Valine	8.4	7.4
Non-essential amino acids
Alanine	6.4	5.6
Aspartic acid	18.3	16.3
Cysteine	2.6	2.2
Glutamic acid	41.4	40.3
Glycine	6.7	6.2
Proline	12.3	11.3
Serine	8.8	7.8
Tyrosine	4.6	4.0
Total amino acid	190.4	181.3

*Determined using water-corrected molecular weights using water-corrected molecular weights.

Table 5. Physical quality of the experimental diets

Protein source	Processing		PDI^1 (%)	Hardness^2 (kg)	Water stability^3 (%)
SBM	Pelleting		94.3^b	8.3^b	82.3
FBP	Pelleting		93.6^c	10.0^a	89.0
SBM	Extrusion		92.7^d	6.2^c	45.7
FBP	Extrusion		95.5^a	6.0^c	59.0
		√MSE*	0.11	1.18	4.02
Protein source
SBM			93.5	7.3	64.0^b
FBP			94.6	8.0	74.0^a
Processing
Pelleting			94.0	9.2	85.7^a
Extrusion			94.1	6.1	52.4^b
P-value
Protein source			<0.001	0.013	0.003
Processing			0.171	<0.001	<0.001
	<0.001		<0.001	0.170

¹Pellet durability index. Values are means of three replicates of 100 g whole pellets.

²Hardness values are means of 20 pellets/diet.

³Values are means of three replicates of 10 g whole pellets.^{a, b, c, d}Means within a column not sharing a common superscript differ at P < 0.05.

Figure 1. Particle size distribution of the diets.

Table 6. Sequences of primers used for quantitative real-time PCR

Gene	F/R	Primer sequence (5ʹ to 3ʹ)	Product size	Gene ID	Reference
HMBS	F: R:	GGCTGGGAGAATCGCATAGG TCCTGCAGGGCAGATACCAT	131	XM_004947916.3	Teng et al. (2020)
LAT1 (SLC7A5)	F: R:	GATTGCAACGGGTGATGTGA CCCCACACCCACTTTTGTTT	70	NM_001030579.2	Kaminski and Wong (2018)
PePT1 (SLC15A1)	F: R:	CCCCTGAGGAGGATCACTGTT CAAAAGAGCAGCAGCAACGA	65	NM_204365.1	Su et al. (2014)
ASCT1 (SLC1A4)	F: R:	TTGGCCGGGAAGGAGAAG AGACCATAGTTGCCTCATTGAATG	63	XM_001232899.5	Paris and Wong (2013)

HMBS: hydroxymethylbilane synthase; LAT1 (SLC7A5): L type amino acid transporter-1; PePT1 (SLC15A1): Peptide transporter-1; ASCT1 (SLC1A4): Alanine, serine, cysteine, and threonine transporter.

Table 7. The effect of dietary protein source¹ and processing method on the growth performance² of male broilers from 17 to 29 d

Protein source	Processing		FI^3	BWG^3	FCR^3
SBM	Pelleting		1919	1510	1.271
FBP	Pelleting		1439	997	1.443
SBM	Extrusion		1940	1562	1.242
FBP	Extrusion		1547	1032	1.499
		√MSE*	73.11	114.77	0.11
Protein source
SBM			1930^a	1536^a	1.257^b
FBP			1493^b	1015^b	1.471^a
Processing
Pelleting			1679^b	1254	1.339
Extrusion			1744^a	1297	1.345
P-value
Protein source			<0.001	<0.001	<0.001
Processing			0.008	0.245	0.547
Protein source x Processing			0.074	0.819	0.179

¹SBM: soybean meal; FBP: faba bean protein fraction

²Values are means of 10 replicate pens of 5 birds each

³Feed intake; Body weight gain; Feed conversion ratio = BWG/FI ^{a, b}Means within a column not sharing a common superscript differ at P < 0.05.

* √MSE: square root of means square error in the analysis of variance.

Table 8. The effect of dietary protein source¹ and processing method on body weight (g), gizzard characteristics and weight (g) of jejunum and ileum with content of 30-d-old male broilers^2.

						Gizzard		Jej+ile
Protein source		Processing		Body w.	Full w.	Content w.	Relative w.^3	Full w.
SBM		Pelleting		2331	19.0	1.7	7.4^c	95.8^a
FBP		Pelleting		1956	21.7	4.5	8.8^b	75.0^b
SBM		Extrusion		2376	20.9	3.6	7.3^c	101.8^a
FBP		Extrusion		1965	26.8	7.5	9.9^a	62.6^c
			√MSE*	148.7	4.3	3.2	0.8	11.7
Protein source
SBM				2354^a	20.0^b	2.7^b	7.4	98.8
FBP				1961^b	24.3^a	6.0^a	9.4	68.8
Processing
Pelleting				2144	20.4^b	3.1^b	8.1	85.4
Extrusion				2171	23.9^a	5.6^a	8.6	82.2
P-value
Protein source				<0.001	0.003	0.002	<0.001	<0.001
Processing				0.573	0.015	0.018	0.104	0.392
Protein source x Processing				0.712	0.265	0.582	0.030	0.017

¹SBM: soybean meal; FBP: faba bean protein fraction

²Values are means of 10 replicate pens (values are the average of two birds per pen)

³Relative empty weight: expressed as g/kg body weight.

^{a, b, c}Means within a column not sharing a common superscript differ at P < 0.05.

*√MSE: square root of means square error in the analysis of variance.

Table 9. The effect of dietary protein source¹ and processing method on nitrogen digestion along the intestinal tract, jejunal trypsin activity (U/mg protein) and ileal digesta viscosity (cp) of 30-d-old male broilers^2.

			Jejunum		Ileum
Protein source	Processing		Upper	Lower	Upper	Lower		Trypsin^3	Viscosity^3
SBM	Pelleting		0.370	0.582	0.711	0.813		0.90	1.38
FBP	Pelleting		0.447	0.708	0.825	0.875		1.01	1.67
SBM	Extrusion		0.255	0.538	0.737	0.823		1.28	1.94
FBP	Extrusion		0.265	0.688	0.824	0.902		1.28	1.86
		√MSE*	0.113	0.061	0.040	0.031		0.49	0.92
Protein source
SBM			0.313	0.560^b	0.724^b	0.818^b		1.01	1.66
FBP			0.356	0.698^a	0.825^a	0.889^a		1.14	1.75
Processing
Pelleting			0.409^a	0.645	0.768		0.844	0.96	1.52
Extrusion			0.260^b	0.613	0.781		0.863	1.28	1.90
P-value
Protein source			0.291	<0.001	<0.001		<0.001	0.341	0.742
Processing			<0.001	0.107	0.346		0.074	0.061	0.260
Protein source x Processing			0.400	0.565	0.307		0.406	0.320	0.582

¹SBM: soybean meal; FBP: faba bean protein fraction.

²Values are means of 10 replicate pens with pooled samples from two birds/pen.

³Values are means of 10 replicate pens with samples from one bird per pen. ^{a, b}Means within a column not sharing a common superscript differ at P < 0.05.

* √MSE: square root of means square error in the analysis of variance

Table 10. The effect of dietary protein source¹ and processing method on the gene expression of nutrient transporters² in the lower jejunum of 30-d-old male broilers^3.

Starch source	Processing		ASCT1^4	LAT1^4	PEPT1^4
SBM	Pelleting		1.000^a	1.000	1.000
vFBP	Pelleting		0.359^b	0.423	0.447
SBM	Extrusion		0.532^b	1.184	0.794
FBP	Extrusion		0.483^b	0.813	0.507
		√MSE*	0.245	0.377	0.367
Protein source			0.766
SBM			0.430	1.092^a	0.897^a
FBP				0.646^b	0.482^b
Processing			0.725
Pelleting			0.507	0.753	0.763
Extrusion				0.998	0.650
P-value			0.001
Protein source			0.039	0.002	0.005
Processing			0.003	0.055	0.541
Protein source x Processing				0.465	0.333

¹SBM: soybean meal; FBP: faba bean protein fraction

²Data are expressed as a ratio of the control group (SBM-Pelleting) value set to 1.000.

³Values are means of eight replicate pens (samples from one bird per pen).

⁴ASCT1: Alanine, serine, cysteine and threonine transporter; LAT1: L-type amino acid transporter-1; PepT1: Peptide transporter-1 ^{a, b}Means within a column not sharing a common superscript differ at P < 0.05.

*√MSE: square root of means square error in the analysis of variance.

Sauvant, D., J. M. Perez, and G. Tran. 2004. Tables of Composition and Nutritional Value of Feed Materials: Pigs, Poultry, Cattle, Sheep, Goats, Rabbits, Horses and Fish. The Netherlands, Wageningen: Wageningen Academic Publishers.

 Google Scholar

Teng, P.-Y., S. Yadav, F. L. de Souza Castro, Y. H. Tompkins, A. L. Fuller, and W. K. Kim. 2020. “Graded Eimeria Challenge Linearly Regulated Growth Performance, Dynamic Change of Gastrointestinal Permeability, Apparent Ileal Digestibility, Intestinal Morphology, and Tight Junctions of Broiler Chickens.” Poultry Science 99: 4203–4216. doi:https://doi.org/10.1016/j.psj.2020.04.031.

 PubMed Web of Science ®Google Scholar

Kaminski, N., and E. Wong. 2018. “Differential mRNA Expression of Nutrient Transporters in Male and Female Chickens.” Poultry Science 97: 313–318. doi:https://doi.org/10.3382/ps/pex262.

 PubMed Web of Science ®Google Scholar

Su, S., K. Miska, R. Fetterer, M. Jenkins, and E. Wong. 2014. “Expression of Digestive Enzymes and Nutrient Transporters in Eimeria Acervulina-challenged Layers and Broilers.” Poultry Science 93: 1217–1226. doi:https://doi.org/10.3382/ps.2013-03807.

 PubMed Web of Science ®Google Scholar

Paris, N., and E. Wong. 2013. “Expression of Digestive Enzymes and Nutrient Transporters in the Intestine of Eimeria Maxima-infected Chickens.” Poultry Science 92: 1331–1335. doi:https://doi.org/10.3382/ps.2012-02966.

 PubMed Web of Science ®Google Scholar