Multilocus molecular phylogenetic-led discovery and formal recognition of four novel root-colonizing Fusarium species from northern Kazakhstan and the phylogenetically divergent Fusarium steppicola lineage

Figures & data

Table 1. Primers used for PCR amplification and sequencing portions of four genes comprising six marker loci.

Locus	Gene product/name	Amplicon size (bp)	Primers	Sequence (5′→3′)^a	Reference
ITS	Internal transcribed spacer	550	ITSF1	CTTGGTCATTTAGAGGAAGTAA	Gardes et al. 1991
			ITS4	TCCTCCGCTTATTGATATGC	White et al. 1990
TEF1	Translation elongation factor 1-alpha	639–683	EF1	ATGGGTAAGGARGACAAGAC	O’Donnell et al. 1998b
			EF2	GGARGTACCAGTSATCATG	O’Donnell et al. 1998b
CaM	Calmodulin	720	CL1	GARTWCAAGGAGGCCTTCTC	O’Donnell et al. 2000
			CL2A	TTTTTGCATCATGAGTTGGAC	O’Donnell et al. 2000
RPB1 A–C	RNA polymerase II, largest subunit, regions A–C	720	RPB1-Af	GARTGYCCDGGDCAYTTYGG	Schoch et al. 2012
			RPB1-Cr	CCNGCDATNTCRTTRTCCATRTA	Schoch et al. 2012
RPB1 D–G	RNA polymerase II, largest subunit, regions D–G	1620	F5	ATGGGTATYGTCCAGGAYTC	O’Donnell et al. 2010
			F7	CRACACAGAAGAGTTTGAAGG	O’Donnell et al. 2010
			G2R	GTCATYTGDGTDGCDGGYTCDCC	O’Donnell et al. 2010
RPB2 5–7	RNA polymerase II, second-largest subunit, regions 5–7	1010	5F2	GGGGWGAYCAGAAGAAGGC	Reeb et al. 2004
			7cR	CCCATRGCTTGYTTRCCCAT	Liu et al. 1999
RPB2 7–11	RNA polymerase II, second-largest subunit, regions 7–11	960	7cF	ATGGGYAARCAAGCYATGGG	Liu et al. 1999
			11aR	GCRTGGATCTTRTCRTCSACC	Liu et al. 1999

^aDegenerate sites in bold indicate the following: Y = C or T; R = A or G; S = G or C; W = A or T; D = A or G or T; N = A or G or T or C.

Figure 1. Phylogenetic tree of 16 representative Fusarium isolates from Kazakhstan (in bold red) and 51 related reference strains of various Fusarium species. The 50% majority rule consensus phylogram was inferred from Bayesian analysis of the combined data set of six loci (TEF1, CaM, RPB1 A–C, RPB1 D–G, RPB2 5–7, and RPB2 7–11). Bayesian posterior probabilities (≥0.90) and ML bootstrap support (≥70) are shown before and after slashes, respectively. Scale bar indicates 0.1 expected changes per site.

Figure 2. Maximum likelihood phylogenetic tree of representative isolates of Fusarium burgessii species complex. Isolates of the novel species from Kazakhstan, F. kazakhstanicum, are shown in bold. RAxML analysis was conducted on combined data set of six loci (TEF1, CaM, RPB1 A–C, RPB1 D–G, RPB2 5–7, and RPB2 7–11). Bayesian posterior probabilities (≥0.90) and ML bootstrap support (≥70) are shown before and after slashes, respectively. Scale bar indicates 0.01 expected changes per site.

Figure 3. Fusarium kazakhstanicum. A–H. Colony morphology after 8 d growth on PDA using a 12/12 h photoperiod. Colony surface is shown on left half of each plate and colony undersurface on right half. A. KG159. B. KG160. C. KG210. D. KG211. E. KG228. F. KG231. G. KG232. H. KG437. I–P. KG160. I–J. Sporodochia on carnation leaf. K. Aerial conidia formed on monophialides. L, P. Microconidia in false heads on monophialides. M. 0–3-septate aerial conidia. N. Chlamydospores. O. Fusiform, mostly 3-septate sporodochial conidia. Bars: I = 1 mm; J–P = 20 μm.

Figure 4. Fusarium rhizicola. A–B. Colony morphology after 8 d growth on PDA using a 12/12 h photoperiod. Colony surface is shown on left half of each plate and colony undersurface on right half. A. KG327. B. KG483. C. Sporodochia of KG327 formed on carnation leaf. D–H. KG483. D. 0-septate and multiseptate aerial conidia. E–F. Microconidia in false heads on monophialides. G–H. Aerial conidia developed on monophialides. Bars: C = 1 mm; D–H =20 μm.

Figure 5. Fusarium campestre (FTSC 12). A–B. Colony morphology after 8 d growth on PDA using a 12/12 h photoperiod. Colony surface is shown on left half of each plate and colony undersurface on right half. A. KG158. B. KG508. C-G. KG158. C. Sporodochia on carnation leaf. D. Microconidia in false head on a long conidiophore. E. Conidiophores producing citriform microconidia. F. Multiseptate fusiform sporodochial conidia. G. 0- to 1-septate and multiseptate aerial and sporodochial conidia, respectively. Bars: C = 1 mm; D–G = 20 μm.

Figure 6. Fusarium steppicola. A–C. Colony morphology after 8 d growth on PDA using a 12/12 h photoperiod. Colony surface shown on left half of each plate and colony undersurface on right half. A. KG107. B. KG142. C. KG192. D–K. KG160. D. Sporodochia formed on carnation leaf. E–G. Aerial conidia formed on monophialides. H–I. Fusiform multiseptate aerial conidia. J. Fusiform multiseptate sporodochial conidia. K. Terminal chlamydospore. Bars: D = 0.5 mm; E–K =20 μm.

Gardes M, White TJ, Fortin JA, Bruns TD, Taylor JW. 1991. Identification of indigenous and introduced symbiotic fungi in ectomycorrhizae by amplification of nuclear and mitochondrial ribosomal DNA. Can J Bot. 69:180–190.

 Google Scholar

White TJ, Bruns T, Lee S, Taylor JW. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, editors. PCR protocols: a guide to methods and applications. New York, NY: Academic Press; p. 315–322.

 Google Scholar

O’Donnell K, Kistler HC, Cigelnik E, Ploetz RC. 1998b. Multiple evolutionary origins of the fungus causing Panama disease of banana: concordant evidence from nuclear and mitochondrial gene genealogies. Proc Nat Acad Sci USA. 95:2044–2049.

 PubMed Web of Science ®Google Scholar

O’Donnell K, Nirenberg HI, Aoki T, Cigelnik E. 2000. A multigene phylogeny of the Gibberella fujikuroi species complex: detection of additional phylogenetically distinct species. Mycoscience. 41:61–78.

 Google Scholar

Schoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, Levesque CA, Chen W, Bolchacova E, Voigt K, Crous PW, et al. 2012. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proc Nat Acad Sci USA. 109:6241–6246.

 PubMed Web of Science ®Google Scholar

O’Donnell K, Sutton DA, Rinaldi MG, Sarver BAJ, Balajee SA, Schroers H-J, Summerbell RC, VARG R, Crous PW, Zhang N, et al. 2010. Internet-accessible DNA sequence database for identifying fusaria from human and animal infections. J Clin Microbiol. 48:3708–3718.

 PubMed Web of Science ®Google Scholar

Reeb V, Lutzoni F, Roux C. 2004. Contribution of RPB2 to multilocus phylogenetic studies of the euascomycetes (Pezizomycotina, Fungi) with special emphasis on the lichen-forming Acarosporaceae and evolution of polyspory. Mol Phylogenet Evol. 32:1036–60.

 PubMed Web of Science ®Google Scholar

Liu YJ, Whelen S, Hall BD. 1999. Phylogenetic relationships among ascomycetes: evidence from an RNA polymerase II subunit. Mol Biol Evol. 16:1799–1808.

 PubMed Web of Science ®Google Scholar