Molecular characterisation of the complete nuclear ribosomal DNA sequence of the blacklip abalone Haliotis rubra

Figures & data

Figure 1. Eukaryotic ribosomal DNA structure.

Table 1. Primers and polymerase chain reaction protocols used in this study.

Region	Primers	Sequence (5′-3′)	Location	Annealing	Extension
18S	18S-ar	AACCTGGTTGATCCTGCCAGT	18S (2–22)	54°C 50 s	72°C 1 min, 30 s
	18S-br	TGATCCTTCTGCAGGTTCA	18S (1857–1838)
ITS	ITS-ar1	TACCGATTGAATGGTTTAGTGAG	18S (1707–1729)	58°C 30 s	72°C 1 min
	ITS-br1	GGTGTTTTGCGATTGCTTAGTC	ITS (481–459)
	ITS-ar2	CGACATCTTGAACGCATATTGC	ITS (395–416)	58°C 30 s	72°C 1 min
	ITS-br2	CCTCACGGTACTTGTTCGCTAT	28S (367–346)
28S	28S-ar1	AAGAGCCCAGCACCGAATC	28S (105–123)	55°C 50 s	72°C 1 min, 30 s
	28S-br1	TGCGTTACCGCACGAGACC	28S (1898–1879)
	28S-ar2	AAATCGTGCTCGCCCTTCC	28S (1797–1815)	52°C 30 s	72°C 1 min
	28S-br2	GAAATCACATTGCGTCAGCACCAG	28S (2468–2444)
	28S-ar3	CGTAACTTCGGGATAAGGATTGG	28S (2181–2203)	55°C 50 s	72°C 1 min, 30 s
	28S-br3	CTTCGCACCATTGGCACCT	28S (3412–3394)
IGS	IGS-ar	CCGCAGGTTCAGACAGTTGGT	28S (3358–3378)	55°C 30 s	72°C 5 min
	IGS-br	TTGGATGTGGTAGCCGTTTCTCA	18S (430–408)

ar: forward primer, br: reverse primer.

Locations refer to the primer location in the sequence.

Table 2. Collected information and GenBank accession numbers for abalone species used in this study.

species	18S	ITS	28S	IGS
H.rubra	MF099780	MF111108	MF099782	MF113042
H. discus hannai	KY485141	KY485145	KY485143	KY569413
H. iris	KY933303	KY933301	KY933305	KY978225
H. discus	AF082177.1	AY146403.1	AY145418.1	—
H. diversicolor	AY698072.1	AF146406.1	EF529461.1	—
H. tuberculata	AF120511.1	AF296860.1	GQ160635.1	—
H. tuberculata tuberculata	FJ605489	FJ605489	—	—
H. tuberculata coccinea	FJ605490	FJ605490	—	—
H. marmorata	FJ605491	FJ605491	—	—
H. corrugata	FJ977644.1	AF296856.1	FJ977675.1	—
H. asinina	GQ160786.1	—	GQ160634.1	—
H. kamtschatkana	AY923882.1	AF296853.1	—	—
H. virginea	AY923881.1	—	—	—
H. midae	AY923883.1	AF296863.1	—	—
H. jacnensis	AY923878.1	—	—	—
H. varia	AY923884.1	—	—	—
H. pustulata	AY923880.1	—	—	—
H. rufenscens	—	AF296855.1	—	—
H. lamellosa	—	AF296862.1	—	—
H. pourtalesii	—	AF296871.1	—	—
H. roei	—	AF296866.1	—	—
H. cyclobates	—	AF296865.1	—	—
H. scalaris	—	AF296864.1	—	—
H. fulgens	—	AF296859.1	—	—
H. cracherodii	—	AF296857.1	—	—
H. sorenseni	—	AF296850.1	—	—
H. roberti	—	AF306942.1	—	—
H. madaka	—	AY146404.1	—	—
H. walallensis	—	AF296854.1	—	—
H. gigantea	—	AY146405.1	—	—

Table 3. Nucleotide composition, length, and GenBank accession number of each rRNA region from H. rubra.

Region	Nucleotide composition (%)				GC content (%)	Length (bp)	GenBank accession number
	T(U)	C	A	G
18S	24.2	22.4	25.3	28.1	50.5	1858	MF099780
ITS	25.9	28.9	18.0	27.3	56.2	756	MF111108
ITS1	26.9	28.4	19.9	24.8	53.2	327	MF106175
5.8S	22.0	28.0	20.5	29.5	57.5	132
ITS2	26.6	29.7	14.7	29.0	58.7	297	MF106174
28S	22.0	23.9	23.4	30.6	54.5	3413	MF099782
IGS	28.6	20.7	24.9	25.8	46.5	3854	MF113042

Note: Because the length of 5.8S rRNA is <150 bp, it could not be submitted to the NCBI GenBank database.

Table 4. Pairwise distances of 18S sequences (lower left matrix) and 28S rDNA sequences (upper right matrix).

	H. midae	H. virginea	H. varia	H. jacnensis	H. pustulata	H. kamtschatkana	H. rubra	H. diversicolor	H. corrugata	H. asinina	H. tuberculata	H. discus	H. discus hannai	H. iris
H. midae
H. virginea	0.004
H. varia	0.002	0.005
H. jacnensis	0.000	0.003	0.002
H. pustulata	0.000	0.003	0.002	0.000
H. kamtschatkana	0.000	0.003	0.002	0.000	0.000
H. rubra	0.000	0.003	0.002	0.000	0.000	0.000		0.029	0.020	0.009	0.007	0.020	0.017	0.016
H. diversicolor	0.000	0.003	0.002	0.000	0.000	0.000	0.000		0.042	0.030	0.026	0.042	0.039	0.038
H. corrugata	0.000	0.003	0.002	0.000	0.000	0.000	0.000	0.000		0.024	0.020	0.007	0.005	0.011
H. asinina	0.000	0.005	0.003	0.002	0.002	0.002	0.002	0.002	0.002		0.011	0.024	0.021	0.020
H. tuberculata	0.002	0.005	0.003	0.002	0.002	0.002	0.002	0.002	0.002	0.003		0.017	0.015	0.014
H. discus	0.008	0.010	0.009	0.007	0.007	0.007	0.007	0.007	0.007	0.009	0.009		0.005	0.011
H. discus hannai	0.000	0.003	0.002	0.000	0.000	0.000	0.000	0.000	0.000	0.002	0.002	0.007		0.009
H. iris	0.002	0.006	0.004	0.002	0.002	0.002	0.002	0.002	0.002	0.004	0.004	0.010	0.002

Note: The bold values were the pairwise distances between H. rubra and other abalone species, in order to reveal and highlight the relationship between H. rubra studied in this paper and other abalone species.

Figure 2. A ML phylogenetic tree was constructed using the ‘GIR + G’ model with 1000 bootstrap replications. The numbers represent the bootstrap value (values <60% are not shown). 2n indicates the diploid chromosome number.

Figure 3. The entire nucleotide sequence of the H. rubra rDNA IGS region. The repeated sequences are underlined as follows: single line for repeat type A and double line for repeat type B. A putative termination signal (poly(T) tract) is in the solid box, and the RNA polymerase I transcription promoter is in the dashed box.

Figure 4. The GC content (%), nucleic acid distribution (% T), and sequence complexity determined using 80-bp windows across the entire rDNA nucleotide sequence of H. rubra.

Figure 5. Dot-matrix comparisons of rDNA sequences. Dot plots indicate comparisons between H. rubra and H. discus hannai and between H. rubra and H. iris.