Hemoglobinopathy gone astray—three novel forms of α-thalassemia in Norwegian patients characterized by quantitative real-time PCR and DNA sequencing

Figures & data

Table 1. Primer sequences for DNA sequencing, break point analysis, gap-PCR, and CNV analysis.

Analysis	Primer	Sequence	Region: Chr 16 (GRCh38/hg38)
PCR and sequencing	HBA1/HBA2 forward^a	CGC GCA TTC CTC TCC GCC C	176185–176203/172381–172399
	HBA1 reverse^a	ATG CCT GGC ACG TTT GCT GAG GG	177546–177568
	HBA2 reverse^a	CAC CTC CAT TGT TGG CAC AT	173744–173763
	HBA1/HBA2-seq1^b	CCC CAA GCA TAA ACC CTG GC	172840–172859/176644–176663
	HBA1/HBA2-seq2^b	CAC CAT ACT CGC CAG CGT GC	172972–172991/176776–176795
Characterization of break points –(NOR)^b	BP-F	CTC TGA GAG CAG CCC AGT CA	169931–169950
	BP-R	AAC CCA CAC CAG GTT CTG CT	185380–185399
–(NOR) gap-PCR^c	NOR-F	CCC TGT CAC CGC TTT TCT TC	160354–160373
	NOR-R	AGG CCG AGG ACC CCT ATC T	174270–174288
Custom made TaqMan^® CNV assays^a	CNV-HBA2-F	TTC CTT CCT CAC CCC ACA TC	171903–171922
	CNV-HBA2-R	GAG AGA AGG CCC CTG TGG TT	171941–171960
	CNV-HBA2-Probe	CCT CAC CTA CAT TCT G	171923–171939
	CNV-HBA3.7-F	CCTCCAGGAAGCCCTCAGA	175623–175641
	CNV-HBA3.7-R	TCACAGGCCCTGAGGAAGTC	175681–175700
	CNV-HBA3.7-Probe	TAACCCTGGTCACCTTGA	175643–175660

^aPrimers used for amplification of NM_000558.4(HBA1) and NM_000517.4(HBA2).

^bSequencing primers.

^cCustom made CNV assays incorporated in HBA-CNV.

Table 2. TaqMan^® assays were used for CNV analysis for the α-globin gene cluster and flanking regions.

#	CNV TaqMan^® assay	Gene/region	Predicted copy number
			–(NOR)	(αα)Aurora Borealis
1	Hs03944594_cn^d	POLR3K	N/A	2
2	HS03941047_cn^d	POLR3K	N/A	1
3	Hs01796374_cn^d	POLR3K	N/A	1
4	Hs01990329_cn^d	POLR3K	N/A	1
5	A1—Hs00290821_cn^b	NPRL3 (HS-40)	2	1
6	A2—HS-40^a	NPRL3 (HS-40)	2	1
7	Hs03920863_cn^d	NPRL3	N/A	1
8	Hs03924657_cn^d	HBZ downstream	N/A	1
9	Hs04462738_cn^d	HBZ downstream	N/A	1
10	Hs03943249_cn^d	HBZ downstream	N/A	1
11	Hs03931715_cn^c,d	HBM upstream	2	1
12	Hs03924537_cn^c,d	HBM upstream	2	1
13	Hs03948127_cn^c,d	HBM upstream	2	1
14	Hs03919944_cn^c,d	HBM downstream	2	2
15	A3—Hs03926638_cn^b	HBA2 upstream	1	2
16	A4—HBA2^a	HBA2 upstream	1	2
17	A5—HBA3.7^a	Between HBA2 and HBA1	1	2
18	A6—HBA3.7^b,e	Between HBA2 and HBA1	1	2
19	A7—Hs03947236_cn^a	HBA1 downstream	1	2
20	A8—Hs03937725_cn^b	HBQ1 upstream	1	2
21	Hs03933778_cn^c	HBQ1 downstream	1	N/A
22	Hs03954413_cn^c	HBQ1 downstream	2	N/A
23	Hs03947151_cn^c	LUC7L upstream	2	N/A
24	Hs03951430_cn^c	LUC7L	2	N/A

N/A: not analyzed.

CNV assays in bold (assay A1–A8) indicate assays used in routine diagnostic where a large deletion is suspected.

Predicted copy number is determined by CopyCaller Software v2.1 (Thermo Fisher Scientific). Two copies indicate no deletion and one copy indicates a deletion.

^aCNV assays described in Grimholt et al. [14].

^bCNV assays are located in proximity to the assays described in Grimholt et al. [14].

^cCNV assay (panel X) was used to estimate the minimum length of the –(NOR) deletion.

^dCNV assay (panel Y) was used to estimate the minimum length of the (αα)Aurora Borealis deletion.

^eCustom made CNV assay (primer and probe sequences are shown in Table S1-online supplementary).

Table 3. Hematological, biochemical, and molecular data of the patients studied.

	Patient	Sex—Age	Hb (g/L)	MCH (pg)	RBC (10^12/L)	Ferritin (µg/L)	CRP (mg/L)	HbA2 (%)	DNA alteration^a
HBA2:c.345delC	I–I	F—48	133	24	5.44	110	N/A	2.8	NM_000517.4(HBA2):345del^b,c
	I–II	M—18	138	25	5.45	N/A	N/A	2.5	NM_000517.4(HBA2):345del^b,c
	II–I	F—62	124	24	5.87	50	N/A	2.7	NM_000517.4(HBA2):345del^b,c
	II–II	F—32	130	25	5.31	N/A	N/A	2.5	NM_000517.4(HBA2):345del^b,c
	III	M—33	137	23	5.87	120	N/A	2.6	NM_000517.4(HBA2):345del^b,c
	IV	F—44	137	24	5.6	36	N/A	3.2	NM_000517.4(HBA2):345del^b,c
	V	F—16	134	25	5.48	83	N/A	2.6	NM_000517.4(HBA2):345del^b,c
	VI	F—18	122	23	5.29	68	N/A	2.5	NM_000517.4(HBA2):345del^b,c
HBA2:c.142_161del	XI	F—31	126	24	5.29	61	N/A	2.8	NM_000517.4(HBA2):142_161del^b,c
–(NOR)	VII–I	F—58	116	22	5.2	83	N/A	2.0	Chr16(GRCh38):g.170677/170694–184083/184100^b,c,d,e
	VII–II	F—78	129	24	5.4	146	<0.6	2.3	Chr16(GRCh38):g.170677/170694–184083/184100^b,d,f
	VII–III	F—29	102	24	4.32	369	N/A	2.6	Chr16(GRCh38):g.170677/170694–184083/184100^b,d,f
	VII–IV	M—83	143	23	6.30	217	1.5	N/A	Chr16(GRCh38):g.170677/170694–184083/184100^b,d,f
	VIII–I	F—43	142	25	5.75	144	<0.6	2.4	Chr16(GRCh38):g.170677/170694–184083/184100^b,d,f
	VIII–II	M—19	139	23	6.09	119	9.0	2.6	Chr16(GRCh38):g.170677/170694–184083/184100^b,d,f
	IX–I	M—80	135	22	6.26	61	<0.6	2.5	Chr16(GRCh38):g.170677/170694–184083/184100^b,d,f
	IX–II	M—45	144	21	6.83	217	1.3	3.0	Chr16(GRCh38):g.170677/170694–184083/184100^b,d,f
(αα)Aurora Borealis	X–I	F—39	119	20	5.94	46	N/A	2.5	Chr16(GRCh38):g.∼50379–165612^b,c,d
	X–II	F—5	113	18	6.27	23	5.2	2.9	Chr16(GRCh38):g.∼50379–165612^b,c,d
	X–III	F—61	134	23	5.84	30	2.0	2.6	Chr16(GRCh38):g.∼50379–165612^b,c,d

Hb: hemoglobin; MCH: mean corpuscular hemoglobin; RBC: Red blood cell count; CRP: C-reactive protein; N/A: Not available.

^aAll in heterozygous state.

^bα-Thalassemia gap-PCR.

^cSanger sequencing of NM_000517.4(HBA2) and NM_000558.4(HBA1).

^dCNV analysis of α-globin gene cluster.

^eDirect sequencing of break point.

^f–(NOR) gap-PCR.

Figure 1. (A) Schematic representation of the small deletions found in HBA2 (NM_000517.4). Solid boxes denote the exons, solid black lines introns and hatched boxes represent the 5′ and the 3′ untranslated regions. The arrows show the location of the two small deletions found in exon 2 and exon 3 of HBA2. (B) Sequencing of the HBA2 gene showing a deletion of a single nt in exon 3 causing a frameshift and a PTC in codon 132. (C) A 20 nt deletion in exon 2 produces a new reading frame starting at codon 47 and ends in a PTC three positions downstream.

Figure 2. (A) Schematic representation of part of 16p13.3 showing a 190 kb region containing the α-globin gene cluster and flanking regions. The solid boxes denote the α-globin like genes and the regulatory region (HS-40). Black bars show the two deletions, –(NOR) and (αα)Aurora Borealis. The open ends indicate the region where the breakpoint is located. Black arrows and numbers indicate the location of the probes. (B) Characterization of breakpoints by gap-PCR and direct sequencing of –(NOR) showed that the deletion starts upstream of HBA2 at position 170677/170694 and ends at position 184083/184100, downstream of HBQ1. The blue box is the 18 nt homologous sequence where the homologous recombination event occurs.

Grimholt RM, Urdal P, Klingenberg O, et al. Rapid and reliable detection of α-globin copy number variations by quantitative real-time PCR. BMC Hematol. 2014;14(1):4.

 PubMedGoogle Scholar