Association of microsatellite polymorphisms with immune responses to a killed Mycobacterium avium subsp. paratuberculosis vaccine in Merino sheep

Figures & data

Table 1. Details of markers used to genotype sheep (n=934) from a trial to evaluate a killed Johne's vaccine on three properties in Australia.

					Primers
Marker	Locus	Chromosome^a	Position (cM)^ab	Repeat	Sequences	Reference	Annealing temperature	PCR reaction^c	Forward primer 5' label^d
DYMS1	DYA	20	17.9	(CA)n	F: 5'AACAACATCAAACAGTAAGAG3' R: 5'CATAGTAACAGATCTTCCTACA3'	Buitkamp et al. (1996)	54°C	Three	PET (Red)
OLADRB	DRB2	20	56.7	(AC)n	F: 5'CTGCCAATGCAGAGACACAAGA3' R: 5'GTCTGTCTCCTGTCTTGTCATC3'	Gruszczynska et al. (2002b)	63°C	Two	NED (Yellow)
SMHCC1	MHC1	20	59.6	(CA)n	F: 5'ATCTGGTGGGCTACAGTCCATG3' R: 5'GCAATGCTTTCTAAATTCTGAGGAA3'	Groth and Wetherall (1994)	58°C	Four	FAM (Blue)
OVINRA1	SLC11A1	2	262.4	(TG)n	F: 5'GCCACGGGTGGGATGAGT3' R: 5'TGAGCTAGGAGATAGCAGG3'	Pitel et al. (1996)	59°C	One	VIC (Green)
o(IFN)-γ	IFNG	3	199.1	TGT (GT3)5 or 6	F: 5'TTGTGACTGTTAGCTAGATGTGTT3' R: 5'ATACACATATTATGCCCATCTTTT3'	Schmidt et al. (1996)	54°C	Three	NED (Yellow)
^a Chromosome and position details as per the Current Sex Averaged, Female, Male Distances for Best Position Maps (v4.7), available online at the Australian sheep gene mapping website (http://rubens.its.unimelb.edu.au/~jillm/jill.htm)
^b Positions of marker loci on respective chromosomes are sex-averaged values
^c Five markers were amplified in four PCR
^d Applied Biosystems, Foster City CA, USA
F = forward primer; R = reverse primer; IFN-γ = interferon-γ

Figure 1. Trends of (a) antibody, and (b) interferon-γ (IFN-γ) responses (LSM ± SE) in sheep vaccinated with a killed Johne's vaccine (---) or unvaccinated (- - -) on three properties (

= Property 1;

= Property 2;

= Property 3) in Australia. Antibody response, and IFN-γ response, which was the difference between responses to Johnin and avian purified protein derivative antigens, were measured as optical density read at 450 nm (OD₄₅₀) in enzyme immunoassays.

Table 2. Allelic and genotypic information pertaining to DYMS1, OLADRB and SMHCC1 loci in sheep from a trial to evaluate a killed Johne's vaccine on three properties (P1, P2, P3), and overall for the three properties, in Australia.

	DYMS1				OLADRB				SMHCC1
Particulars	P1	P2	P3	Overall	P1	P2	P3	Overall	P1	P2	P3	Overall
Number of sheep	301	300	292	893	308	289	284	881	313	302	280	895
Number of alleles^a	20(7)	15(5)	11(2)	21(9)	11(2)	9(2)	9(2)	12(3)	15(5)	14(4)	13(5)	16(5)
Allelic range (bp)	160–210	158–202	164–206	158–210	264–296	270–296	264–296	264–296	180–210	176–210	180–210	176–210
Most frequent allele^b	192(21.8)	190(29.5)	202(24.1)	190(15.6)	276(29.6)	276(36.7)	296(25.0)	276(30.0)	194(24.8)	194(26.2)	194(23.8)	194(24.9)
Number of genotypes^a	75(40)	51(24)	43(13)	92(58)	43(17)	30(8)	27(9)	47(23)	54(29)	52(22)	39(17)	76(50)
Most frequent genotype^b	186/192(7.0)	190/196(8.3)	184/202(12.7)	184/202(4.6)	276/276(11.4)	276/296(19.7)	270/296(14.4)	276/296(11.5)	192/194(14.4)	194/202(8.9)	194/198(14.3)	192/194(10.2)
Allelic diversity (%)	87.4	83.6	85.3	88.6	82.8	77.5	79.8	82.0	83.6	85.9	82.6	85.7
Heterozygosity(%)	83.4	82.3	90.1	85.2	76.3	79.9	85.9	80.6	86.9	87.8	85.0	86.6
PIC	0.862	0.818	0.836	0.874	0.808	0.746	0.768	0.798	0.817	0.845	0.804	0.842
HWE exact p-value^c	0.156	0.039	0.026	0.001	0.041	0.332	0.327	0.001	0.079	0.547	0.069	0.001
^a Values in parentheses denote the number of alleles/genotypes with a frequency of <1%
^b Values in parentheses denote percentage of respective alleles/genotypes
^c Exact probability of being wrong in rejecting the Hardy-Weinberg equilibrium (HWE) hypothesis
bp = base pairs; PIC = polymorphic information content

Table 3. Allelic and genotypic information pertaining to OVINRA1 and o(interferon)-γ (o(IFN)-γ) loci in sheep from a trial to evaluate a killed Johne's vaccine on three properties (P1, P2, P3), and overall for the three properties, in Australia.

	OVINRA1				o(IFN)-γ
Particulars	P1	P2	P3	Overall	P1	P2	P3	Overall
Number of sheep	316	293	286	895	304	294	292	890
Number of alleles^a	9(2)	8(2)	8(1)	10(4)	2(0)	2(0)	2(0)	2(0)
Allelic range (bp)	150–170	154–168	156–170	150–170	124–128	124–128	124–128	124–128
Most frequent allele^b	162(36.1)	162(24.6)	162(36.7)	162(32.5)	124(67.1)	124(73.3)	124(84.6)	124(74.9)
Number of genotypes^a	27(9)	21(4)	22(4)	30(11)	3(0)	3(0)	3(0)	3(0)
Most frequent genotype^b	162/164(14.9)	162/164(14.7)	160/162(17.5)	162/164(15.0)	124/124(45.7)	124/124(52.7)	124/124(71.2)	124/124(56.4)
Allelic diversity (%)	78.2	79.8	76.3	79.0	44.2	39.1	26.1	37.6
Heterozygosity(%)	79.8	77.1	79.4	78.8	42.8	41.2	26.7	37.0
PIC	0.753	0.767	0.729	0.761	0.344	0.315	0.227	0.305
HWE exact p-value^c	0.506	0.053	0.150	0.002	0.603	0.456	0.824	0.595
^a Values in parentheses denote the number of alleles/genotypes with a frequency of <1%
^b Values in parentheses denote percentage of respective alleles/genotypes
^c Exact probability of being wrong in rejecting the Hardy-Weinberg equilibrium (HWE) hypothesis
bp = base pairs; PIC = polymorphic information content

Table 4. Allelic and genotypic differences between properties and groups within properties, pertaining to five microsatellite marker loci in sheep from a trial to evaluate a killed Johne's vaccine on three properties (P1, P2, P3) in Australia.

Particulars	DYMS1	OLADRB	SMHCC1	OVINRA1	o(IFN)-γ
Allelic differentiation^a
Group-wise
P1 C vs P1 V	x	NS	NS	NS	NS
P2 C vs P2 V	x	NS	NS	NS	NS
P3 C vs P3 V	NS	NS	NS	NS	NS
Property-wise
P1 vs P2	y	y	y	y	x
P1 vs P3	y	y	y	y	y
P2 vs P3	y	y	y	y	y
Genotypic differentiation^b
Group-wise
P1 C vs P1 V	NS	NS	NS	NS	NS
P2 C vs P2 V	y	NS	NS	NS	NS
P3 C vs P3 V	NS	NS	NS	NS	NS
Property-wise
P1 vs P2	y	y	y	y	x
P1 vs P3	y	y	y	y	y
P2 vs P3	y	y	y	y	y
^a Fisher's exact test (Raymond and Rousset 1995b)
^b Log-likelihood exact test (Goudet et al. 1996)
^x Significance of difference p<0.05
^y Significance of difference p<0.01
o(IFN)-γ = o(interferon)-γ; C = control; V = vaccinate; NS = non-significant (p>0.05)

Table 5. Marker genotypes and alleles found to have significant and consistent effects on interferon-γ (IFN-γ) responses in vaccinated sheep from a trial to evaluate a killed Johne's vaccine on three properties (P1, P2, P3) in Australia.

	Effect^a on IFN-γ responses				Overall effect^b
Marker	Genotype/allele (bp)	P1	P2	P3	Effect	Classification
Genotype
DYMS1	186/200	Low, significant	Low, significant	Low, significant	Low	Most likely
OLADRB	272/276	Low, non-significant	Low, significant	Low, significant	Low	Probable
SMHCC1	194/202	Low, significant	Low, non-significant	Low, significant	Low	Most likely
OVINRA1	156/158	Low, significant	Low, significant	Genotype absent	Low	Probable
o(IFN)-γ	128/128	High, significant	High, significant	High, significant	High	Most likely
Allele
DYMS1	202	Low, non-significant	Low, significant	Low, significant	Low	Probable
OLADRB	284	Low, non-significant	Low, significant	Low, significant	Low	Probable
o(IFN)-γ	124	Low, significant	Low, significant	Low, significant	Low	Most likely
^a Significance of effect: significant = p<0.05; non-significant = p>0.05; genotype absent = particular genotype had insufficient numbers and hence its effect was not evaluated
^b Overall effect was based on consistency and significance of genotype/allele effects: Most likely = particular genotype/allele had a significant and similar, either low or high, effect across the three properties; Probable = particular genotype/allele had a significant and similar, either low or high, effect on two properties and either a similar but non-significant effect or was absent on the other property
bp = base pairs

Buitkamp , J , Filmether , P , Stear , MJ and Epplen , JT . 1996 . Class I and class II major histocompatibility complex alleles are associated with faecal egg counts following natural, predominantly Ostertagia circumcincta infection . Parasitology Research , 82 : 693 – 696 .

 PubMed Web of Science ®Google Scholar

Gruszczynska , J , Swidarek , W , Charon , KM , Kuryl , J , Cieslak , D and Pierzchala , M . 2002b . Microsatellite polymorphism of pseudo-gene OLA-DRB2 in intron 5 in two Polish sheep breeds . Animal Science Papers and Reports , 20 : 67 – 72 .

 Google Scholar

Groth , DM and Wetherall , JD . 1994 . Dinucleotide repeat polymorphism within the ovine major histocompatibility complex class I region . Animal Genetics , 25 : 61 – 61 .

 PubMed Web of Science ®Google Scholar

Pitel , F , Lantier , I , Gellin , J , Elsen , JM and Lantier , F . 1996 . Two polymorphic microsatellite markers close to the ovine NRAMP gene . Animal Genetics , 27 : 60 – 61 .

 Google Scholar

Schmidt , P , Ludt , C , Kuhn , CH and Buitkamp , J . 1996 . A diallelic tetranucleotide repeat (GT3)5 or 6, within intron 1 of the ovine interferon-γ gene . Animal Genetics , 27 : 437 – 438 .

 Google Scholar

Raymond , M and Rousset , F . 1995b . An exact test for population differentiation . Evolution , 49 : 1280 – 1283 .

 PubMed Web of Science ®Google Scholar

Goudet , J , Raymond , M , De Meeüs , T and Rousset , F . 1996 . Testing differentiation in diploid populations . Genetics , 144 : 1933 – 1940 .

 PubMed Web of Science ®Google Scholar