Detection of Leishmania (L.) infantum in stray dogs by molecular techniques with sensitive species-specific primers

Figures & data

Table 1. Characterization of oligonucleotide primers used for species-specific amplification of Leishmania infantum (GenBank accession n.AF308682.1). The position is based on the numbering in the original sequence where the first base of the inset at the 5’ end is the number 1.

							BLASTn (%) – L. infantum^§			BLASTn – others^§				Self-dimer^‡
Primer	Sequence (5’–3’)	Size*	Strand	Position^†	Tm (°C)	GC (%)	MI (%)	QC (%)	E-value	MI (%)	QC (%)	E-value	Hairpin^‡	5’–3’	3’–5’
Lch1	GTCGGAAACTAATCCGCAAA	20	Sense	448–467	60.07	45.00	100	100	0.071	100	90^a	1.1	0	1	2
Lch2	TGAAACTGGCCTCCTAGTGC	20	Antisense	621–640	60.40	55.00	100	100	0.071	100	85^b	4.4	0	1	1
Lch3	TGCACTGTTTTGGTGGTTTC	20	Antisense	604–623	59.59	45.00	100	100	0.071	100	100^c	17	0	0	1
Lch4	GAAATTGGCCTCCCTGAGTT	20	Antisense	650–669	60.44	50.00	100	100	0.071	100	90^d	1.1	0	0	2
Lch5	GAGTTGGATTGGGCTGAAAC	20	Antisense	635–654	59.53	50.00	100	100	0.071	100	95^e	0.28	0	0	0
Lch6	GTTGGATTGGGCTGAAACTG	20	Antisense	633–652	60.50	50.00	100	100	0.071	100	100^f	1.1	0	0	0
Lch7	TTGCGCACGTTATATCTACAGG	22	Sense	247–268	60.17	45.45	100	100	0.007	100	90^g	20	0	1	3
Lch8	AGTTTCCGACACTGACTTGGTT	22	Antisense	436–457	60.07	45.45	100	100	0.007	100	95^h	26	0	0	1
Lch9	TCACTCATATTCCAACCACCAG	22	Sense	85–106	59.85	45.45	100	100	0.007	100	90^i; 100^j	0.11; 26	0	0	1
Lch10	GGATACGATAGCGTAGGCAGAC	22	Antisense	308–329	60.14	54.55	100	100	0,007	95	100^k	1.7	0	1	2
Lch11	TTCACTCATATTCCAACCACCA	22	Sense	84–105	60.23	40.91	100	100	0.007	100	100^l	26	0	0	1
Lch12	ACGCTATCGTATCCCCTATTGA	22	Sense	316–337	59.85	45.45	100	100	0.007	100	100^m	0.007	0	0	3
Lch13	TTGATGGTATGGGTGTTCTTTG	22	Antisense	464–485	59.72	40.91	100	100	0.007	100	95^n	6.5	0	0	0
Lch14	CGCACGTTATATCTACAGGTTGAG	24	Sense	250–273	60.10	45.83	100	100	<0.001	100	75^o	11	0	0	4
Lch15	TGTTTGGGATTGAGGTAATAGTGA	24	Antisense	393–416	59.77	37.50	100	100	<0.001	100	75^p	2.8	0	0	0
Lch16	ATTAGTTTCCGACACTGACTTGGT	24	Antisense	437–460	60.32	41.67	100	100	<0.001	100	91^q	2.8	0	0	1
Lch17	GGTGTTTGGGATTGAGGTAATAGT	24	Antisense	395–418	59.57	41.67	100	100	<0.001	100	95^r	0.7	0	0	0
Lch18	GGATTTTTCGGATTTTCACTCATA	24	Sense	70–93	60.51	33.33	100	100	<0.001	100	100^s	11	0	0	1
Lch19	CGTGCGCAATATTTCTACTCTCTA	24	Antisense	232–255	59.96	41.67	100	100	<0.001	100	100^t; 95^u	11; 43	0	0	4
Lch20	CAGCCAACATATAAACGTAGCAAG	24	Sense	114–137	60.10	41.67	100	100	<0.001	100	95^v	43	0	1	1
Lch21	GGGTATTTCAATAGGGGATACGAT	24	Antisense	321–344	60.49	41.67	100	100	<0.001	100	100^w	0.7	0	1	2

* Primer size (nucleotides).

^† Position relative to the sequence shown in the Figure 1.

^‡ *Quantity of events when ΔG ≤ −3.50 kcal mol⁻¹.

^§ MI, maximum percent identity; QC, query coverage; E-value, expect value

^a Enterococus faecium (CP003583.1); ^bLeishmania infantum (AB678348.1), L. donovani (FJ416603.1), L. tropica (AF308690.1), Canis familiaris (AC186205.3); ^cMyceliophthora thermophila (CP003004.1), Podospora anserina (CU633897.1); ^dCanis lupus familiaris (NM_001010944.1), Desulfohalobium retbaense (CP001734.1); ^eProchlorococcus marinus (CP000825.1, CP000576.1, CP000551.1); ^fPectobacterium carotovorum (CP001657.1), Gallus gallus (NM_001256123.1), Arabidopsis thaliana (CP002685.1); ^gMesoplasma florum (AE017263.1); ^hSpirochaeta sp. (CP003155.1); Homo sapiens (AC103749.2, AC117832.6, AC009432.7); ^IMus musculus (JN952224.1), Vitis vinifera (AM423279.2); ^jArcobacter sp. (AP012048.1); ^kL. infantum (EU437407.1), L. donovani (L19877.1, FJ416603.1); ^lListeria monocytogenes (FR733642.2, FR733643.2, FR733644.2, FR733646.2), Schistosoma mansoni (HE601631.1); ^mL. infantum (EU437407.1), L. donovani (FJ416603.1, L19877.1); ⁿSchistosoma mansoni (HE601631.1); ^oArabidopsis thaliana (CP002685.1), Mus musculus (AC102324.9), Clostridium acidurici (CP003326.1); ^pStaphylococcus aureus (AP003367.1), S. epidemidis (AE015933.1); ^qCyprinus carpio (JN725618.1); ^rPaenibacillus sp. (CP001656.1); ^sDyadobacter fermentans (CP001619.1), Arabidopsis thaliana (CP002687.1); ^tDrosophila melanogaster (AE014297.2); ^uSchistosoma mansoni (HE601627.1); ^vSchistosoma mansoni (HE601631.1), Arabidopsis thaliana (CP002687.1); ^w Candidatus Liberibacter solanacearum (CP002371.1), Bacillus cereus (AP007209.1).

Figure 1. The original full-length sequence of the Leishmania infantum (GenBank accession n.AF308682.1). The locations of our proposed primer sequences are indicated by underlines. Antisense primers are designated by italic format, while nonitalic form indicates sense primers.

Figure 2. Median (25% and 75% percentiles) parasite load distributed by the sex in the 69 studied animals (statistics: Mann--Whitney test=136.00; p-value=0.09).