Global gene expression analyses reveal changes in biological processes after hyperthermia in a rat glioma model

Figures & data

Figure 1. Outline of sample collection. We analyzed global gene expression at 0, 45, 90 and 180 min in the four treatment groups in vivo, at 0, 180 and 300 min in the in vitro control group (3 samples), and at 0, 60, 180 and 300 minutes in the in vitro HT group (4 samples). *, equal amounts of total RNA from four parallel samples were mixed and analyzed as one by the microarrays; bar, indicate HT treatment session; arrow, CTX or saline injected at start of HT; MA, microarray.

Table I.  RT-PCR primer sequences

Gene	Codon	Sequence	Strand	Ref.
p53	124–222	5′ acgtactcaatttccctcaa 3′	+	[19]
		5′ ctcaggtggctcatacggta 3′	−
	202–294	5′ gagtatctggacgacaggca 3′	+	[19]
		5′ caatgctcttcttttttgcg 3′	−
	280–347	5′ cgtcggacagaggaagaaaa 3′	+	[19]
		5′ tccaaggcctcattcagctc 3′	−
p16	1–41	5′ atggagtcctctgcagataga 3′	+	[21]
		5′ atcggggtacgaccgaaagtgtt 3′	−
	43–146	5′ gtgatgatgatgggcaacgt 3′	+	[20]
		5′ gggcgtgcttgagcagaag 3′	−
	28–72	5′ cttcaccaaacgccccgaacac 3′	+	[21]
		5′ cgggagagggtggtggggtc 3′	−
Hras		5′ agcccctgtagaagcgatg 3′	+
		5′ tggtgttgttgatggcaaat 3′	−
Kras2		5′ aaggcctgctgaaaatgactgag 3′	+
		5′ agccctccccagttctcatgta 3′	−
Nras		5′ ggcgggtctgcggagttt 3′	+
		5′ cccgcttaatttgctccctgta 3′	−
Braf		5′ tggcgacgtggcagtgaaaatg 3′	+
		5′ gcgggccagcagctcaataga 3′	−

sense (+) and antisense (−).

Figure 2. Supervised screen for HSP and genes involved in the immune system in the dataset of 1213 genes found differentially expressed after HT by SAM analysis in vivo. (A) HSPs differentially expressed in vivo and (B) the corresponding HSP genes in vitro. (C) genes involved in the immune system, especially HSP, T-cell, NK cell and APC related genes. Only a few genes involved in this immune system cluster were also differentially expressed in vitro (data not shown).Genes analyzed and displayed as single channel data, p-values, Student's t-test. (D) and (E) Immunohistochemical staining of CD8 positive cells (cytotoxic T-lymphocytes and NK cells) (D) and MHC class II Ia positive cells (B-lymphocytes, dendritic cells and macrophages) (E), pictures display representative staining from the periphery of a tumor treated with hyperthermia, percentage of positive cells displayed in the graphs. Pictures taken at x400 resolution, 25 µm scale bar. The figures have been proportionally adjusted in size after composition. No other adjustments of pictures.

Table II.  GO biological processes overrepresented (p < 0.05) in a cluster of 1213 genes differently expressed (SAM analysis) after hyperthermia in a rat glioblastoma like tumor model.

GO terms sorted in groups (hierarchi indicated when close relationship)	Exact test p-value	Genes in selection (n = 1213)	Genes in reference (n = 21358)	Fold change
MAIN GO PROCESSES
biological process	0.0040	412	6464	1.1
cellular process	0.0070	280	4293	1.1
cell communication	0.0040	132	1827	1.3
signal transduction	0.0030	129	1764	1.3
multicellular organismal process	0.0360	82	1170	1.2
regulation of cellular process	0.0320	69	956	1.3
DIFFERENTIATION AND APOPTOSIS
cell development	0.0290	24	271	1.6
cell death	0.0130	23	237	1.7
programmed cell death	0.0120	22	222	1.7
apoptosis	0.0100	22	216	1.8
regulation of apoptosis	0.0006	13	72	3.2
negative regulation of programmed cell death	0.0020	19	151	2.2
negative regulation of apoptosis	0.0020	19	149	2.2
anti-apoptosis	0.0040	15	115	2.3
positive regulation of programmed cell death	0.0130	18	170	1.9
positive regulation of apoptosis	0.0120	18	168	1.9
induction of apoptosis	0.0110	15	130	2.0
induction of apoptosis by extracellular signals	0.0480	4	22	3.2
negative regulation of developmental process	0.0070	5	18	4.9
negative regulation of cell differentiation	0.0140	4	14	5.0
oligodendrocyte differentiation	0.0260	2	3	11.7
regulation of myoblast differentiation	0.0370	2	4	8.8
TRANSCRIPTION
RNA biosynthetic process	0.0250	47	605	1.4
transcription, DNA -dependent	0.0250	47	605	1.4
regulation of transcription, DNA-dependent	0.0420	32	400	1.4
positive regulation of transcription from RNA polymerase II promoter	0.0420	13	129	1.8
IMMUNE SYSTEM
Immune system process	0.0002	20	132	2.7
leukocyte activation	0.0001	20	120	2.9
myeloid leukocyte activation	0.0110	4	13	5.4
lymphocyte activation	0.0004	17	108	2.8
regulation of lymphocyte activation	0.0030	8	39	3.6
positive regulation of lymphocyte activation	0.0100	6	29	3.6
positive regulation of T cell activation	0.0040	6	23	4.6
T cell costimulation	0.0370	2	4	8.8
T cell activation	0.0090	8	47	3.0
T cell differentiation	0.0100	6	29	3.6
thymic T cell selection	0.0360	3	11	4.8
lymphocyte proliferation	0.0180	5	24	3.7
T cell proliferation	0.0240	4	17	4.1
localization of cell	0.0300	19	202	1.7
cell motility	0.0300	19	202	1.7
cell migration	0.0320	11	98	2.0
leukocyte migration	0.0150	6	32	3.3
leukocyte chemotaxis	0.0180	5	24	3.7
lymph node development	0.0090	4	12	5.9
immune response -regulating cell surface receptor signaling pathway	0.0040	5	16	5.5
immune response -activating cell surface receptor	0.0040	5	16	5.5
antigen receptor -mediated signaling pathway	0.0040	5	16	5.5
T cell receptor signaling pathway	0.0030	4	8	8.8
B cell receptor signaling pathway	0.0370	2	4	8.8
homeostasis of number of cells	0.0430	3	12	4.4
leukocyte homeostasis	0.0430	3	12	4.4
lymphocyte homeostasis	0.0300	3	10	5.3
T cell homeostasis	0.0100	3	6	8.8
activated T cell apoptosis	0.0260	2	3	11.7
BLOOD VESSELS
vasculature development	0.0170	15	137	1.9
blood vessel development	0.0140	15	134	2.0
blood vessel morphogenesis	0.0120	14	119	2.1
angiogenesis	0.0110	12	94	2.2
positive regulation of angiogenesis	0.0300	3	10	5.3
blood vessel remodeling	0.0240	3	9	5.9
regulation of vascular permeability	0.0370	2	4	8.8
CELL SIGNALING
intracellular signaling cascade	0.0220	50	644	1.4
activation of MAPKKK activity	0.0370	2	4	8.8
calcium -mediated signaling	0.0100	5	20	4.4
regulation of calcium-mediated signaling	0.0140	3	7	7.5
positive regulation of calcium-mediated	0.0140	3	7	7.5
Cell recognition	0.0140	3	7	7.5
compartment specification	0.0070	3	5	10.6
interspecies interaction between organisms	0.0240	3	9	5.9
symbiosis, encompassing mutualism through	0.0240	3	9	5.9
cytokine production	0.0450	8	66	2.1
positive regulation of tumor necrosis factor-alpha	0.0370	2	4	8.8
Notch signaling pathway	0.0130	5	22	4.0
RESPONSE TO STIMULUS
response to stimulus	0.0000	128	1194	1.9
immune response	0.0000	29	202	2.5
inflammatory response to antigenic stimulus	0.0160	2	2	17.6
defense response	0.0002	14	72	3.4
cellular defense response	0.0030	8	38	3.7
response to stress	0.0260	15	145	1.8
response to heat	0.0170	4	15	4.7
response to biotic stimulus	0.0230	13	117	2.0
response to other organism	0.0120	13	106	2.2
antimicrobial humoral response	0.0260	6	37	2.9
antimicrobial humoral response (sensu Vertebrata)	0.0210	6	35	3.0
response to external stimulus	0.0000	39	309	2.2
response to wounding	0.0002	31	257	2.1
wound healing	0.0290	10	84	2.1
blood coagulation	0.0320	6	39	2.7
inflammatory response	0.0010	19	145	2.3
taxis	0.0140	9	62	2.6
chemotaxis	0.0140	9	62	2.6
response to chemical stimulus	0.0050	29	296	1.7
response to protein stimulus	0.0004	8	26	5.4
response to unfolded protein	0.0004	8	26	5.4
response to organic substance	0.0190	7	44	2.8
response to mercury ion	0.0370	2	4	8.8
TRANSPORT
Golgi to secretory vesicle transport	0.0370	2	4	8.8
polyol transport	0.0160	2	2	17.6
vesicle -mediated transport	0.0110	19	180	1.9
endocytosis	0.0140	12	97	2.2
serotonin secretion	0.0260	2	3	11.7
sulfate transport	0.0020	4	7	10.1
gas transport	0.0100	3	6	8.8
oxygen transport	0.0070	3	5	10.6
CYTOSKELETON
cytoskeletal anchoring	0.0370	2	4	8.8
Actin cytoskeleton reorganization	0.0370	2	4	8.8
stress fiber formation	0.0370	2	4	8.8
METABOLIC/PROTEIN MODIFICATIONS
protein amino acid dephosphorylation	0.0050	11	72	2.7
protein folding	0.0390	8	64	2.2
positive regulation of protein metabolic process	0.0470	5	32	2.8
positive regulation of peptidyl-tyrosine	0.0170	4	15	4.7
glycoprotein metabolic process	0.0280	9	71	2.2
glycoprotein biosynthetic process	0.0170	8	54	2.6
protein amino acid glycosylation	0.0350	7	51	2.4
regulation of a molecular function	0.0260	14	132	1.9
regulation of catalytic activity	0.0100	14	115	2.1
positive regulation of enzyme activity	0.0070	3	5	10.6
coenzyme metabolic process	0.0370	4	20	3.5
hyaluronan metabolic process	0.0370	2	4	8.8

Processes are sorted in ten main groups. Subgroups are hierarchically indicated. p-value, statistical overrepresentation of genes involved in a biological process in the subgroup compared to the reference group (all genes), Student's t test. Fold change, relative overrepresentation.

Table III.  Selected biological processes representing five main groups of GO terms overrepresented after HT.

ABI probe	NCBI RefSeqs	Gene symbol	FDR[i]	Fold change (in vivo)	p-value (in vivo)	Fold change (in vitro)	p-value (in vitro)	Subgroups
Immune system
21548910	NM_134327	Cd69	<0.001	−5.33	<0.001
21152019		Vegfa	0.268	1.76	<0.001
22095143	XM_237999	Gadd45g	0.963	2.01	0.002
21828181	NM_053843	Fcgr3	1.661	−1.40	0.001
22029786	NM_012758	Syk	1.840	1.73	0.004
21416213	NM_001011912	Polm	0.666	−2.32	0.001
21706219		Bcl2	<0.001	−2.04	<0.001
22258004	NM_021866	Ccr2	<0.001	−3.61	<0.001
21879663	NM_053960	Ccr5	0.878	−2.23	0.002
21383549	NM_198769	Tlr2	<0.001	−2.44	<0.001
21475372	NM_207604	Tlr6	<0.001	−3.34	<0.001
20987091	NM_021744	Cd14	<0.001	−1.90	<0.001	−2.37	0.001
22207732	NM_001001969	Ly6g6c	<0.001	2.13	<0.001
21363695	NM_053469	Hamp	<0.001	1.89	<0.001
21374705	NM_013049	Tnfrsf4	0.311	−3.49	0.001			Immune response (p < 0.001)
22410097		Col4a3bp_predicted	0.246	−1.37	<0.001
21875447		Ccr7	0.475	−2.84	0.001
21878860	NM_031674	Ctla4	0.425	−2.36	0.001
22409902		Notch1	0.619	1.91	0.001
21315092	NM_001004210	Xbp1	0.734	−1.45	<0.001
21660673	NM_017097	Ctsc	0.718	−1.76	0.001
20862268	NM_013163	I l2ra	1.168	−2.26	0.003
21595006	NM_212507	Ltb	1.210	−2.17	0.003
22348045	XM_234930	Edg6_predicted	1.390	−3.12	0.006
21993897		Il7r_predicted	1.540	−2.01	0.004
22129016	NM_080889	Il2rg	1.853	−1.61	0.003
21997851		II18M_predicted	2.048	−1.89	0.006
21671727	NM_133624	Gbp2	2.216	−2.04	0.008
21760369	NM_017167	Oprk1	0.700	2.03	0.001
21130826	NM_012830	Cd2	0.457	−3.05	0.001
21552382	NM_001012469	Il21r	<0.001	−3.11	<0.001
22117831	NM_022610	I cos	<0.001	−4.24	<0.001
21765894		Tcrb	1.331	−2.26	0.004
22257881	NM_012922	Casp3	1.110	−1.49	0.001
20862268	NM_013163	Il2ra	1.168	−2.26	0.003
22029786	NM_012758	Syk	1.840	1.73	0.004
21295294		Cd3e_predicted	0.282	−3.77	0.001
21811167	NM_138507	Ptprc	1.931	−1.69	0.004			Lymfocyte activation (p < 0.001)
21856159	NM_013169	Cd3d	2.304	−2.16	0.009
20730028	NM_012551	Egr1	0.810	3.84	0.003	11.21	0.030
21697087	NM_139194	Tnfrsf6	1.179	−1.90	0.002
21440771	XM_232763	Lck_mapped	1.353	−2.01	0.004
21371521	NM_022205	Cxcr4	<0.001	−1.93	<0.001
21103539	NM_019295	Cd5	0.789	−2.79	0.003
21887404	NM_001013191	Cbfb	1.597	−1.39	0.001	1.29	0.012
21416213	NM_001011912	Polm	0.666	−2.32	0.001
Apoptosis
21706219		Bcl2	<0.001	−2.04	<0.001
22257881	NM_012922	Casp3	1.110	−1.49	0.001
21937474	NM_080906	Ddit4	0.243	−2.35	0.001
21274662	NM_001008321	Gadd45b	1.547	1.94	0.004	2.70	0.002
22363901	XM_573634	Hdh	2.337	1.51	0.004
20862268	NM_013163	Il2ra	1.168	−2.26	0.003
21150134	NM_019163	Psen1	0.777	−1.83	0.001
22136990	NM_012908	Tnfsf6	2.236	−1.85	0.007
21622943	NM_001025696	Yars	1.105	1.40	<0.001
22205126	NM_001011936	Bag3	<0.001	4.71	<0.001	6.64	<0.001
22406016		Bcl2l2	2.251	−1.82	0.007			Apoptosis (p = 0.010)
22039472	NM_017258	Btg1	0.541	−1.62	<0.001
21295294		Cd3e_predicted	0.282	−3.77	0.001
21723217		Creb1	0.472	−1.49	<0.001
21632602		Hip1	1.949	−1.45	0.002
21880142	NM_022229	Hspd1	0.403	1.81	<0.001	1.55	0.004
22248260	NM_001013101	Moap1	1.611	−1.53	0.002
21821093	NM_172322	Pycard	2.339	−1.43	0.002
21986321	NM_031831	Rtn4	1.491	−1.42	0.001
22024288	NM_053360	Sh3kbp1	1.529	1.33	<0.001
21541068		Tcf7_predicted	<0.001	−1.94	<0.001
21374705	NM_013049	Tnfrsf4	0.311	−3.49	0.001
Transcription
20795343		Arid3a_predicted	0.276	−1.93	<0.001
21030397	NM_012912	Atf3	<0.001	9.55	<0.001	10.49	0.007
22037258		Bbx_predicted	0.816	−1.59	0.001
21291776		Ccnt2_predicted	0.308	1.50	<0.001	1.64	0.036
21612923		Cic_predicted	1.837	2.02	0.006
21268234		Cpsf6_predicted	0	−1.98	<0.001
21723217		Creb1	0.472	−1.49	<0.001
21320369	NM_001005562	Creb3l1	1.581	1.63	0.002	−1.25	0.042
20730028	NM_012551	Egr1	0.810	3.84	0.003	11.21	0.030
21663546	NM_001017381	FN1	0.433	−1.85	<0.001
22022961	NM_022197	Fos	0.306	7.24	0.001
20977804		Heyl_predicted	1.549	2.53	0.006
21906936	XM_216426	Jmjd2c_predicted	0.641	−1.76	0.001
22313734	NM_021835	Jun	0.953	2.72	0.003
21423437	NM_053777	Mapk8ip	2.043	2.11	0.008
22421138		MGC72997	0.312	−2.16	<0.001			Regulation of transcription
21405916	NM_020087	Notch3	<0.001	2.06	<0.001			DNA dependent (p = 0.042)
21844607	XM_344662	Nrg2	<0.001	4.39	<0.001
21821093	NM_172322	Pycard	2.339	−1.43	0.002
22379717	NM_001012468	Rab18	0.453	−1.46	<0.001
20915253	XM_235439	RGD1311188_predicted	0.714	−1.80	0.001
21541068		Tcf7_predicted	<0.001	−1.94	<0.001
22012172	XM_342644	Tfec	1.027	−1.83	0.002
21315092	NM_001004210	Xbp1	0.734	−1.45	<0.001
21858810	NM_213564	Zbtb9	0.695	−1.51	<0.001
21624224	NM_133323	Zfp111	0.661	−2.23	0.001
21372383	NM_001012169	Zfp143	1.848	1.30	<0.001
21903027		Zfp161	<0.001	−1.79	<0.001
22270825		Zfp212	2.08	−1.35	0.001	−1.82	0.005
20927543	XM_345907	Zfp426	1.464	−1.74	0.003
21809729		Znf124_predicted	0	−2.49	<0.001
22016522	NM_019620	Znf386	0	−2.04	<0.001
Blood vessels
22039472	NM_017258	Btg1	0.541	−1.62	<0.001
21371521	NM_022205	Cxcr4	<0.001	−1.93	<0.001
21321753	NM_031327	Cyr61	1.506	4.58	0.008	8.92	0.003
21584942	NM_017301	Edg1	2.455	−1.87	0.008
21798241	NM_053599	Efna1	0.750	−1.64	<0.001
21010125	NM_012580	Hmox1	0.507	5.88	0.002	14.54	<0.001	Angiogenesis (p = 0.011)
21389601	NM_012797	Id1	1.255	−1.99	0.003
22409902		Notch1	0.619	1.91	0.001
21986321	NM_031831	Rtn4	1.491	−1.42	0.001
20957826	NM_001001513	Tnfsf12	<0.001	1.78	<0.001
21152019		Vegfa	0.268	1.76	<0.001
21996686		Vegfb	2.058	1.43	0.002
Protein modifications
22205126	NM_001011936	Bag3	<0.001	4.71	<0.001	6.64	<0.001
22357645	NM_012935	Cryab	<0.001	7.55	0.001	25.22	0.005
20732724	XM_341663	Dnajb1_predicted	<0.001	6.07	<0.001	18.68	<0.001
20816663	XM_342763	Fkbp4	0.288	1.49	<0.001	2.53	0.002	Protein folding (p = 0.039)
21290384	NM_001012174	Fkbp5	0.614	−1.92	0.001
21880142	NM_022229	Hspd1	0.403	1.81	<0.001	1.55	0.004
21605052	NM_012966	Hspe1	1.316	1.93	0.003
21544995	NM_022247	Pdcl	1.899	−1.45	0.002
21267573	XM_227618	Cdc14a_predicted	1.587	−1.77	0.004
21990429		Cdc14b_predicted	0.890	−2.16	0.002
21812963		Dusp19_predicted	<0.001	2.71	<0.001
22408694	NM_001012089	Dusp2	1.799	−3.57	0.009
21327095	NM_022199	Dusp4	<0.001	8.41	<0.001	4.29	0.003	Protein amino acid dephosphorylation (p = 0.005)
22323879	XM_341963	Dusp8_predicted	2.076	2.16	0.008
21800532	NM_022538	Ppap2a	0.296	−1.58	<0.001
21854294	NM_017041	Ppp3ca	0.516	−1.46	<0.001
21454610	NM_017309	Ppp3r1	1.381	−2.06	0.004
21811167	NM_138507	Ptprc	1.931	−1.69	0.004
21328078		Sbf1_predicted	0.545	1.51	<0.001

ABI probe, Applied Biosystems microarray probe ID; NCBI RefSeqs, National Center for Biotechnology Information (NCBI) gene ID; FDR(i), false discovery rate from SAM analysis, cut off at 2.5 (%). Processes illustrated are: Regulation of transcription, DNA dependent (GO:0006355), Angiogenesis (GO:0001525, Protein folding (GO:0006457) and Protein amino acid dephosphorylation (GO:0006470). Apoptosis (GO:0006915), Immune response (GO:0006955), Lymfocyte activation (GO:00466449).

Figure 3. Real time RT-PCR results in vivo (A–D) and in vitro (E–H). All samples are expressed as ratios of concentration of probe of interest versus a control probe, adjusted so that the mean of the controls at the first time point (in vitro) or all time points (in vivo) equals one. (I) statistical results in vitro, p-values from Student's t-test are presented.

Figure 4. Tentative diagram for the interaction between DUSP1 and HSPs. The diagram has been simplified for illustrative purposes. See text for details. P; phosphorylated, T; transcription.

Makino H, Ishizaka Y, Tsujimoto A, Nakamura T, Onda M, Sugimura T, Nagao M. Rat p53 gene mutations in primary Zymbal gland tumors induced by 2-amino-3-methylimidazo[4,5-f]quinoline, a food mutagen. Proc Natl Acad Sci USA 1992; 89: 4850–4854

 PubMed Web of Science ®Google Scholar

Swafford DS, Middleton SK, Palmisano WA, Nikula KJ, Tesfaigzi J, Baylin SB, Herman JG, Belinsky SA. Frequent aberrant methylation of p16INK4a in primary rat lung tumors. Mol Cell Biol 1997; 17: 1366–1374

 PubMed Web of Science ®Google Scholar

Rollins LA, Leone-Kabler S, O'Sullivan MG, Miller MS. Role of tumor suppressor genes in transplacental lung carcinogenesis. Mol Carcinog 1998; 21: 177–184

 PubMed Web of Science ®Google Scholar