Re-aerosolization in liquid-based air samplers induces bias in bacterial diversity

Figures & data

Video abstract

Read the transcript

Watch the video on Vimeo

Figure 1. Experimental protocol for sampling each of the four bacteria strains and the bacterial consortium using Coriolisµ^® and the BioSampler^®.

Table 1. Bacterial strains included in this study.

Strains	Lactobacillus paracasei	Moraxella catarrhalis	Pseudomonas aeruginosa	Staphylococcus aureus
Strain	HER-1319	ATCC 8176	ATCC 27853	ATCC 25923
Shape	Rod	Coccus	Rod	Coccus
Arrangement	Chains/Pairs	Pairs/Short chains	Isolated/Pairs	Grape-like clusters
Length (µm)	0.7–1.1 × 2.0–4.0	0.6–1.0	0.5–1.0 × 1.5–3.0	0.5–1.0
Gram	Positive	Negative	Negative	Positive
Cell surface hydrophobicity^a	Hydrophilic	Hydrophobic	Hydrophilic	Hydrophobic
Aggregation^b	+++	++	+	++
Phylum	Firmicutes	Proteobacteria	Proteobacteria	Firmicutes

^a Cell surface hydrophobicity test by Rosenberg, Gutnick, and Rosenberg (1980).

^b Auto-aggregation test by Malik et al. (2003) (+++ > 50%, ++ = 20%–30% and + < 20%).

Table 2. Primers and probes used in this study.

Microorganisms	Primers and probes	Sequence (5′ to 3′)	Final concentration (nmol/L)	PCR thermoprotocol	References
S. aureus	Saureus2F	ATACGCCTCTCCACGCATAATC	200	Denaturation : 95 °C - 3 min	Perrott et al. 2017
	Saureus2R	CAGTAACTACGCACTATCATTCAGC	200	Annealing : 95 °C - 10 s
				Elongation : 61 °C - 30 s
P. aeruginosa	Pae-4F	CGGCAACTACGGCTTCAAC	200	Cycles : 40
	Pae-4R	GCGGAACGAGTGACCTTGG	200	Initial melt step :95 °C - 10 s
				Melt curve : 65-95 °C in 0.5 °C increments for 5 s
M. catarrhalis	Mor-F	GTGAGTGCCGCTTTACAACC	500	Denaturation : 95 °C – 3 min	Greiner et al. 2003
	Mor-R	TGTATCGCCTGCCAAGACAA	500	Annealing : 95 °C - 10 s	Perrott et al. 2017
	Mor-TM	FAM-TGCTTTTGCAGCTGTTAGCCAGCCTAA-BHQ_1	100	Elongation : 60 °C - 30 s
L. paracasei	LactoF	TGGATGCCTTGGCACTAGGA	600	Cycles : 40	Haarman & Knol 2006
	LactoR	AAATCTCCGGATCAAAGCTTACTTAT	600		Perrott et al. 2017
	LactoP	FAM-TATTAGTTC/ZEN/CGTCCTTCATC- IABkFQ/	150
Total bacteria	EUB F	GGTAGTCYAYGCMSTAAACGT	625	Denaturation : 95 °C - 3 min	Bach et al. 2002
	EUB R	GACARCCATGCASCACCTG	625	Annealing : 95 °C - 20 s
	EUB P	FAM-TKCGCGTTGCDTCGAATTAAWCCAC-IBFMFQ	125	Elongation : 62 °C - 1 min
				Cycles : 40

Figure 2. The 37 mm cassette filter connected to the BioSampler^®.

Figure 3. Relative ratios of genome copy numbers of each single strain and the bacterial consortium when added to the BioSampler^® and the Coriolisµ^® collection fluid. The geometric forms represent each value of the relative ratio obtained for the five replicates (n = 5). The error bars represent standard deviation and the vertical bold lines represent the mean value of the relative ratios.

Figure 4. Comparisons of alpha-diversity metrics of observed OTUs (a) and Chao1 (b) for natural bioaerosols collected with two sampler types (liquid and filter). Each horizontal line in the boxes represents the minimum, the average and the maximum of the observed OTUs (n = 3).

Figure 5. Principal-coordinate analysis of air samples collected with two different types of air samplers.

Figure 6. Relative abundance of the bacterial phyla collected using liquid- and filter-based samplers.

Figure 7. Relative abundances of bacterial genera collected using liquid and filter type samplers. (Please see supplemental information for a complete legend).

Figure 8. Venn diagram of the genera (relative abundance) collected by the BioSampler® and those re-aerosolized from the collection fluid captured by the BioSampler^® cassette.

Rosenberg, M., D. Gutnick, and E. Rosenberg. 1980. Adherence of bacteria to hydrocarbons – a simple method for measuring cell-surface hydrophobicity. FEMS Microbiol. Lett. 9 (1):29–33. doi: 10.1111/j.1574-6968.1980.tb05599.x.

 Web of Science ®Google Scholar

Malik, A., M. Sakamoto, S. Hanazaki, M. Osawa, T. Suzuki, M. Tochigi, and K. Kakii. 2003. Coaggregation among nonflocculating bacteria isolated from activated sludge. Appl. Environ. Microbiol. 69 (10):6056–6063. doi: 10.1128/AEM.69.10.6056-6063.2003.

 PubMed Web of Science ®Google Scholar

Perrott, P., N. Turgeon, L. Gauthier-Levesque, and C. Duchaine. 2017. Preferential aerosolization of bacteria in bioaerosols generated in vitro. J. Appl. Microbiol. 123 (3):688–697. doi: 10.1111/jam.13514.

 PubMed Web of Science ®Google Scholar

Greiner, O., P. J. R. Day, M. Altwegg, and D. Nadal. 2003. Quantitative detection of Moraxella catarrhalis in nasopharyngeal secretions by real-time PCR. J. Clin. Microbiol. 41 (4):1386–1390. doi: 10.1128/JCM.41.4.1386-1390.2003.

 PubMed Web of Science ®Google Scholar

Haarman, M., and J. Knol. 2006. Quantitative real-time PCR analysis of fecal lactobacillus species in infants receiving a prebiotic infant formula. Appl. Environ. Microbiol. 72 (4):2359–2365. doi: 10.1128/AEM.72.4.2359-2365.2006.

 PubMed Web of Science ®Google Scholar

Bach, H. J., J. Tomanova, M. Schloter, and J. C. Munch. 2002. Enumeration of total bacteria and bacteria with genes for proteolytic activity in pure cultures and in environmental samples by quantitative PCR mediated amplification. J. Microbiol. Methods 49 (3):235–245. doi: 10.1016/S0167-7012(01)00370-0.

 PubMed Web of Science ®Google Scholar

Data availability

Raw sequence reads of the samples used in this study have been deposited in the National Center for Biotechnology Information (NCBI) under BioProject PRJNA531492.