Modelling Aspergillus fumigatus infections in racing pigeons (Columba livia domestica)

Figures & data

Table 1.  Primer sequences for multiplication of microsatellites A, B, C and D (Bart-Delabesse et al., 1998)

Microsatellite	Primer sequences (5′ to 3′)
A	GCCTACGATGACCGAAATGA
	CTGTTTTGAGAAGCGGATGG
B	TTGCCATCGCTTGTCATAGA
	GCAGGTGGTTCAATAGGACAG
C	CGAAGCTCTCCCCTGCAAATC
	GATGCCGCTGGTGGTGTTGT
D	AGGGATACGGCTACGGACAA
	AAAGCGTCTGTCAGCGTGTCT

Table 2.  Average total weight loss as a percentage of the initial weight in pigeons, either inoculated with A. fumigatus or sham inoculated, at 7 days p.i. (or at euthanasia)

Group	Weight loss (%)
HBSS in right thoracic air sac (n=4)	−1.3^a
HBSS in right lung (n=4)	−3.6^a
Dexamethasone (n=7)	1.4
A. fumigatus in right thoracic air sac (n=4)	8.1
A. fumigatus in right lung (n=4)	6.6
A. fumigatus in right thoracic air sac after dexamethasone injections (n=4)	−0.011^a
A. fumigatus in right lung after dexamethasone injections (n=4)	8.9
A. fumigatus in trachea after dexamethasone injections (n=4)	12.4
^aNegative weight loss value = weight gain.

Table 3.  Average daily clinical scores for dyspnea and the presence or absence of ruffled feathers per day in pigeons, either inoculated with A. fumigatus or sham inoculated

Day p.i.	Group 1	Group 2	Group 3	Group 4	Group 5	Group 6	Group 7	Group 8
Dyspnea score
1	0	0	0	0	0	0	0	0
2	0	0	0	0	0	–^a	0	0
3	0	0	0	1	0.48	–^a	0.2	0.5
4	0	0	0	0.1	0.25	–^a	–^a	0.4
5	0	0	0	0.3	0.4	–^a	–^a	0.7
6	0	0	0	–^a	0.2	–^a	–^a	0.4
7	0	0	0	–^a	0.27	–^a	–^a	0.67
Fraction of pigeons with ruffled feathers
1	0/4	0/4	0/7	1/4	1/4	1/4	2/4	0
2	0/4	0/4	2/7	3/4	1/4	–^a	3/4	2/4
3	0/4	0/4	0/5	1/2	0/4	–^a	1/1	2/4
4	0/4	0/4	0/5	1/2	2/4	–^a	–^a	3/4
5	0/4	0/4	0/5	1/2	1/3	–^a	–^a	3/4
6	0/4	0/4	0/5	–^a	0/3	–^a	–^a	1/3
7	0/4	0/4	0/5	–^a	1/3	–^a	–^a	1/3
Group 1, HBSS in right thoracic air sac; Group 2, HBSS in right lung; Group 3, dexamethasone; Group 4, A. fumigatus in right thoracic air sac; Group 5, A. fumigatus in right lung; Group 6, A. fumigatus in right thoracic air sac after dexamethasone injections; Group 7, A. fumigatus in right lung after dexamethasone injections; Group 8, A. fumigatus in trachea after dexamethasone injections. ^aAll pigeons died.

Table 4.  Daily mortality in pigeons, either inoculated with A. fumigatus or sham inoculated

Day p.i.	Group 1	Group 2	Group 3	Group 4	Group 5	Group 6	Group 7	Group 8
1
2			2			4	2
3				2			1
4				1			1
5				1	1			1
6
7
Total	0	0	2/7	4/4	1/4	4/4	4/4	1/4
Group 1, HBSS in right thoracic air sac; Group 2, HBSS in right lung; Group 3, dexamethasone; Group 4, A. fumigatus in right thoracic air sac; Group 5, A. fumigatus in right lung; Group 6, A. fumigatus in right thoracic air sac after dexamethasone injections; Group 7, A. fumigatus in right lung after dexamethasone injections; Group 8, A. fumigatus in trachea after dexamethasone injections.

Table 5.  Pathological and mycological findings in pigeons inoculated with A. fumigatus

Organ	Number of animals showing lesions (L) and number of animals from which A. fumigatus was isolated (I)^a
	Group 4		Group 5		Group 6		Group 7		Group 8
	L	I	L	I	L	I	L	I	L	I
Trachea swab	0	0	0	0	0	1	0	2	3	1
Left abdominal air sac	4	0	2	0	1	0	2	1	4	1
Right abdominal air sac	4	2	1	1	1	4	2	1	2	0
Left thoracic air sac	4	3	2	0	2	1	2	1	4	0
Right thoracic air sac	4	2	2	1	4	3	2	1	4	0
Left lung	2	3	1	2	2	4	0	3	4	1
Right lung	2	3	4	1	2	4	4	4	4	1
Pericard	4	2	1	1	3	2	2	1	0	0
Heart	0	1	0	0	0	1	0	0	0	1
Liver	4	4	1	1	4	4	3	3	1	0
Spleen	4	–^b	4	^b	0	–^b	1	–^b	0	–^b
Kidney	2	0	0	0	3	3	1	1	0	0
Brain	1	1	0	0	0	0	0	0	0	0
Ascites	4	2	1	0	1	1	0	–^b	0	–^b
Pectoral muscle	2	1	1	1	4	2	3	0	1	0
^aEach group consisted of four animals. Group 4, A. fumigatus in right thoracic air sac; Group 5, A. fumigatus in right lung; Group 6, A. fumigatus in right thoracic air sac after dexamethasone injections; Group 7, A. fumigatus in right lung after dexamethasone injections; Group 8, A. fumigatus in trachea after dexamethasone injections. ^bNot determined.

Bart-Delabesse , E. , Humbert , J.-F. , Delabesse , E. and Bretagne , S. 1998 . Microsatellite markers for typing Aspergillus fumigatus isolates . Journal of Clinical Microbiology , 36 : 2413 – 2418 .

 PubMed Web of Science ®Google Scholar