Characterization of field and vaccine infectious bursal disease viruses from Nigeria revealing possible virulence and regional markers in the VP2 minor hydrophilic peaks

Figures & data

Figure 1. Diagram representing primer pair positioning used in an overlapping and nested format to sequence the genome of IBDV segment A (VP2, VP3, VP4 and VP5). Numbers depict the first nucleotide position bound by the primer in accordance with numbering by Bayliss et al. (1990); F, forward primer; R, reverse primer.

Table 1. Primers used to amplify and sequence IBDV VP2 and genome segment A.

Primer	Sequence 5′→3′	Melting temperature (°C)	Reference
728 F4	AGTGACAGGCCCAGAGTCTACAC	60.9	Owoade et al. (2004)
1282 R1	CTGAACTAGCAAAGAACCTGGT	55.9	Owoade et al. (2004)
1213 R4	GAAAGAGTGGCAACAGGATC	54.9	Owoade et al. (2004)
1 F	GGATACGATCGGTCTGAC	53.2	Owoade et al. (2004)
42 F	GTCACCYKGGGACAGGC	55.4	Present study
633 F	GGTAACYGTCCTCAGCTTA	50.6	Present study
1265 R	GTTCAGGATTTGGGATCAGC	55.1	Owoade et al. (2004)
972 F	CGGCACTGACAACCTTAT	53.7	Present study
1822 R	ATAGCGTGGCACCCTCT	57.1	Present study
1736 F	CYGTAGTCGACGGGATTCT	52.8	Present study
2654 R	GCTGTCCCGTACTTGGCYCTT	58.9	Present study
2158 F	CYCAAYGCYTRTGGCGAGATT	58.7	Lojkic et al. (2008)
2745 R	GGTGTTGCAAAGTAGATGCCC	58.0	Owoade et al. (2004)
2506 F	GGAAGAGAATGGGATTGTGAC	54.6	Owoade et al. (2004)
3166 R	CTCAAGGTCCTCATCAGAGAC	55.5	Owoade et al. (2004)
2696 F	CTTCTTTGAGATCCGTGTGTC	54.5	Owoade et al. (2004)
3176 R	CAGGAGCCTCACTCAAGGTC	58.5	Lojkic et al. (2008)

Table 2. Origin of field and vaccine IBDV-positive samples as tested with PCR.

IBDV sample	GenBank accession number	Sampling date and location	Flock type	Flock size	Mortality (%)	Age (weeks)
IBDV1	JX424047	03/10 Kaduna	Broiler	100	6 (day 1)	5
IBDV2	JX424048	08/09 Kaduna	Pullet	50	51	4
IBDV4	JX424049	01/11 Kano	Broiler	50	70	3
IBDV8	JX424050	07/10 Kaduna	Cockerel	130	39	2
IBDV10	JX424051	03/06 Kaduna	Cockerel	40	NA	4
IBDV11	JX424052	04/10 Kaduna	Pullet	400	87	5
IBDV12	JX424053	12/10 Katsina	Broiler	200	20 (day 1)	3
IBDV13	JX424054	05/10 Katsina	Pullet	2000	70	4
IBDV17	JX424055	05/09 Kaduna	Pullet	428	51	10
IBDV22	JX424056	03/10 Kaduna	Pullet	1000	NA	3
IBDV25	JX424057	05/10 Kaduna	Cockerel	50	100	6
IBDV27	JX424058	01/11 Kaduna	Broiler	200	NA	7
IBDV33	JX424059	01/11 Abuja	Pullet	12000	NA	12
IBDV34	JX424060	01/11 Zamfara	Pullet	21000	78	4
IBDV36	JX424061	12/10 Katsina	Broiler	450	NA	3
IBDV37	JX424062	08/09 Kaduna	Cockerel	10	80	7
IBDV38	JX424063	12/10 Kano	Pullet	600	NA	6
IBDV40	None	11/01 Kano	Pullet	2000	NA	10
IBDV43	JX424064	01/11 Kaduna	Broiler	400	20 (day 1)	4
IBDV44	None	08/09 Kaduna	Cockerel	10	60	7
IBDV49	JX424065	08/10 Kaduna	Cockerel	6000	3 (day 3)	5
IBDV51	JX424066	07/10 Kaduna	Broiler	300	27 (day 3)	5
IBDV55	None	05/09 Kaduna	Pullet	470	43	14
IBDV57	None	03/06 Kano	Pullet	NA	NA	NA
IBDV58	JX424067	02/10 Kaduna	Pullet	2350	25 (day 2)	4
IBDV59	JX424068	05/10 Abuja	Pullet	50000	NA	4
IBDV60	None	11/09 Kano	Pullet	10000	NA	17
IBDV61	JX424069	09/09 Kaduna	Pullet	12500	NA	6
IBDV62	None	01/10 Kaduna	Cockerel	34	NA	3
IBDV63	JX424070	05/09 Kaduna	Pullet	100	29	8
IBDV64	JX424071	01/10 Kaduna	Pullet	1000	43 (day 3)	6
IBDV65	JX424072	08/09 Kaduna	Pullet	100	NA	6
IBDV68	None	04/09 Kaduna	Pullet	1200	9	18
IBDV71	JX424073	01/10 Kaduna	Cockerel	7	NA	4
IBDV73	JX424074	07/09 Kaduna	Broiler	200	NA	5
IBDV76	JX424075	Vom Vaccine
IBDV77	JX424076	Georgia Vaccine
IBDV78	JX424077	ABIC Vaccine
IBDV79	JX424078	03/11 Kaduna	Cockerel	65	NA	9
IBDV80	JX424079	06/11 Kaduna	Broiler	40	NA	6

Note: Sampling date presented as month/year. NA, information not available.

Figure 2. Amino acid sequence alignment for the VP2 hypervariable region from positions 211 to 351 numbering according to Bayliss et al. (1990). Nigerian field IBDV strains and imported vaccine strains in comparison with classical IBDV strain D78 and vvIBDV reference strain UK/89/661. Dots, identical residue; boxes, VP2 minor hydrophilic peaks; broken box, region with most attenuating mutations.

Table 3. Comparison of segment A amino acids for vaccine and field IBDV strains in northwestern Nigeria.

Region	Position	Georgia	ABIC	IBDV80	IBDV49	IBDV2	IBDV79	IBDV10	IBDV34
VP5	14	K	–	E	–	–	*	*	*
	27	T	–	S	–	–	*	*	*
	40	S	–	T	T	T	*	*	*
	41	G	–	R	R	R	*	*	*
	45	G	R	R	R	R	*	*	*
	49	S	–	T	T	T	*	*	*
	74	I	F	L	F	F	*	*	*
	102	A	–	–	T	T	*	*	*
	125	S	P	P	P	P	*	*	*
	133	R	W	W	W	W	*	*	*
	134	N	H	H	H	H	*	*	*
VP2	198	D	G	G	G	G	*	*	*
	222	P	A	A	A	A	A	A	–
	242	V	I	I	I	I	I	I	–
	253	H	Q	Q	Q	Q	Q	Q	L
	254	G	–	–	S	S	S	S	–
	256	V	I	I	I	I	I	I	–
	270	T	A	A	A	A	A	A	–
	272	I	T	T	–	–	–	–	–
	279	N	–	–	D	D	D	D	–
	284	T	A	A	A	A	A	A	–
	294	L	I	I	I	I	I	I	–
	299	N	S	S	S	S	S	S	–
	300	E	–	–	A	A	A	A	–
	315	S	–	–	–	–	–	–	–
	330	R	S	S	S	S	S	S	–
	355	E	–	–	–	–	–	–	–
	372	E	–	–	–	–	–	–	–
	451	I	L	L	*	L	L	L	–
VP4	471	H	–	Q	*	Q	Q	Q	–
	486	Q	–	L	*	L	L	L	–
	527	P	T	–	*	–	–	–	–
	541	V	I	I	*	I	I	I	–
	549	D	–	–	*	–	–	–	–
	550	C	–	–	*	–	–	–	–
	563	I	–	–	M	–	–	–	*
	575	L	–	–	V	–	–	–	*
	623	R	–	–	G	–	–	–	*
	642	K	N	–	–	–	–	–	*
	654	N	–	–	K	–	–	–	*
	680	C	Y	Y	Y	Y	Y	Y	*
	685	K	N	S	S	S	S	S	*
	702	R	K	K	K	K	K	K	*
	715	P	S	S	S	S	S	S	*
VP3	745	N	S	S	S	S	S	C	*
	751	H	D	D	D	D	D	D	*
	761	E	–	G	G	G	G	G	*
	981	L	P	P	P	P	P	*	–
	990	A	V	–	–	–	V	*	–
	1005	T	A	–	*	A	A	*	–

Note: Amino acid position numbering is according to Kibenge et al. (1990). –, amino acid identical with Georgia vaccine; *sequence not determined.

Figure 3. Global distribution of IBDV VP2 amino acid types at positions 299 and 300 numbering according to Bayliss et al. (1990) (ND; NK; SK; NG; NQ; RQ; SQ; SA; NV; NE and SE) as possible regional markers.

Figure 4. Amino acid sequence alignment for the VP2 hypervariable region from positions 212 to 331 numbering according to Bayliss et al. (1990). Nigerian IBDV strain IBDV2/Kaduna.NG/2009 with A300 in comparison with other sequences having different amino acids at position 300. Dots, identical residues; boxes, VP2 minor hydrophilic peaks; broken box, region with most attenuating mutations; double-headed arrows, virulence markers; vertical arrows, regional markers.

Table 4. Comparison of IBDV VP2 amino acid positions 299 and 300 as proposed regional markers for different countries.

	Regional marker^Footnotea
Country	Indigenous	Foreign
South Africa	18 ^BCD (ND=17; SQ=1)	18 ^BCD (NE=2; SE=16)
Venezuela	5 ^BE (NK=4; DK=1)	31 ^BE (NE=17; SE=14)
Malaysia	37 ^E (SE=34; SK=3)	8 ^E (NE)
China	155 ^ACD (SE=143; NG=10; SG=2)	44 ^ACD (NE=43; SA=1)
Ivory Coast	5 ^BCE (NQ)	1 ^BCE (SE)
Nigeria	77 ^ABCDE (SA=75; SQ=2)	12 ^ABCDE (SE=11; NE=1)
USA	291 ^ABD (NE=287; NV=4)	114 ^ABD (SE=113; NG=1)
Australia	26 ^ACD (SE)	2 ^ACD (NE=1; SK=1)
Spain	41 ^AE (SE)	66 ^AE (NE=64; NK=2)

^a Total indigenous and foreign regional markers (data outside parentheses) were compared between five countries in five different groups—(Australia; China; Nigeria; Spain; USA), (Australia; China; Nigeria; South Africa; USA), (Australia; China; Ivory Coast; Nigeria; South Africa), (Ivory Coast; Nigeria; South Africa; USA; Venezuela), and (Ivory Coast; Malaysia; Nigeria; Spain; Venezuela)—with Fisher's exact test. However, the identities of markers are provided in parentheses. Data with the same uppercase letters are significantly different at P<0.0001.

Figure 5. Phylogenetic analysis based on nucleotides 765 to 1127 of the VP2 hypervariable region for Nigerian IBDVs, imported vaccine strains and other strains with identical regional marker (A300). Two reference strains were included and labels indicate country of origin: circles, Nigeria (black, northwest; grey, southwest; blank, not specified); black triangle, India; grey triangle, Dominican Republic; black square, Zambia; grey square, Tanzania; black diamond, Nepal; grey diamond, Bangladesh; blank diamond, China. 5a: Cluster of vvIBDV strains from different countries associated with a 48% bootstrap value. 5b: Three clusters of field IBDV associated with vaccine and reference strains with a 100% bootstrap value.

Figure 6. Phylogenetic analysis of the complete segment A region of vaccine and field IBDVs from northwestern Nigeria and other regions of the world. Black circles indicate significant association between field and vaccine IBDV strains. Cluster of vvIBDV (I) and classical IBDV (II) strains.

Supplementary Table S1. Statistical test for association between proposed infectious bursal disease virus regional markers and different groups of countries

Regional Marker					Statistics
countries		Foreign	Indigenous	Total	Test	Value	df	Asymp. Sig. (2-sided)	Exact Sig. (2-sided)
(a)	Australia	2	26	28
	China	44	156	200
	Nigeria	12	77	89	χ^2	77.744	4	.000	.000
	Spain	66	41	107	Likelihood ratio	74.592	4	.000	.000
	USA	114	291	405	Fisher's exact	72.966			.000
Total		238	591	829	N of Valid Cases	829
(b)	Australia	2	26	28
	China	44	156	200
	Nigeria	12	77	89	χ^2	26.012	4	.000	.000
	South Africa	18	18	36	Likelihood ratio	26.623	4	.000	.000
	USA	114	291	405	Fisher's exact	25.491			.000
Total		190	567	757	N of Valid Cases	757
(c)	Australia	2	26	28
	China	44	156	200
	Ivory Coast	1	5	6	χ^2	24.254	4	.000	.000
	Nigeria	12	77	89	Likelihood ratio	22.379	4	.000	.000
	South Africa	18	18	36	Fisher's exact	21.573			.000
Total		77	281	358	N of Valid Cases	358
(d)	Ivory Coast	1	5	6
	Nigeria	12	77	89
	South Africa	18	18	36	χ^2	72.361	4	.000	.000
	USA	114	291	405	Likelihood ratio	69.985	4	.000	.000
	Venezuela	31	5	36	Fisher's exact	68.716			.000
Total		176	396	572	N of Valid Cases	572
(e)	Ivory Coast	1	5	6
	Malaysia	8	37	45
	Nigeria	12	77	89	χ^2	88.070	4	.000	.000
	Spain	66	41	107	Likelihood ratio	95.109	4	.000	.000
	Venezuela	31	5	36	Fisher's exact	92.809			.000
Total		118	165	283	N of Valid Cases	283

Bayliss, C.D., Spies, U., Shaw, K., Peters, R.W., Papageorgiou, A., Muller, H. & Boursnell, M.E.G. (1990). A comparison of the sequences of segment A of four infectious bursal disease virus strains and identification of a variable region in VP2. Journal of General Virology, 71, 1303–1312.

 PubMed Web of Science ®Google Scholar

Owoade, A.A., Mulders, M.N., Kohnen, J., Ammeriaan, W. & Muller, C.P. (2004). High sequence diversity in infectious bursal disease virus serotype 1 in poultry and turkey suggests West-African origin of very virulent strains. Archives of Virology, 149, 653–672.

 PubMed Web of Science ®Google Scholar

Lojkic, I., Bidin, Z. & Pokric, B. (2008). Sequence analysis of both genome segments of three Croatian infectious bursal disease field viruses. Avian Diseases, 52, 513–519.

 PubMed Web of Science ®Google Scholar

Kibenge, F.S.B., Jackwood, D.J. & Mercado, C.C. (1990). Nucleotide sequence analysis of genome segment A of infectious bursal disease virus. Journal of General Virology, 71, 569–577.

 PubMed Web of Science ®Google Scholar