T-2 toxin impairs antifungal activities of chicken macrophages against Aspergillus fumigatus conidia but promotes the pro-inflammatory responses

Figures & data

Table 1. Genes and sequences of the primers used for qRT-PCR analysis.

Cytokine		Primer sequence (5′ to 3′)	Amplicon size (base pairs)	Accession number	Reference
β-actin	Forward	CAACACAGTGCTGTCTGGTGG	205	X00182	Lu et al. (2009)
	Reverse	ATCGTACTCCTGCTTGCTGAT
GAPDH	Forward	ATTCTACACACGGACACTTCA	153	K01458	Mohammed et al. (2007)
	Reverse	CACCAGTGGACTCCACAACATA
IL-1β	Forward	TGGGCATCAAGGGCTACA	244	Y15006	Hong et al. (2006)
	Reverse	TCGGGTTGGTTGGTGATG
IL-6	Forward	GCTCGCCGGCTTCGA	71	AJ309540	Beeckman et al. (2010)
	Reverse	GGTAGGTCTGAAAGGCGAACAG
TGF-β4	Forward	AGGATCTGCAGTGGAAGTGGAT	137	M31160	Beeckman et al. (2010)
	Reverse	CCCCGGGTTGTGTTGGT
CCLi2	Forward	GGCAGACTACTACGAGACCAACAG	70	AJ243034	Beeckman et al. (2010)
	Reverse	ACGGCCCTTCCTGGTGAT
CXCLi1	Forward	TGGCTCTTCTCCTGATCTCAATG	527	AF277660	Beeckman et al. (2010)
	Reverse	GCACTGGCATCGGAGTTCA
CXCLi2	Forward	GCCCTCCTCCTGGTTTCAG	923	AJ009800	Beeckman et al. (2010)
	Reverse	TGGCACCGCAGCTCATT
IL-12β	Forward	TGAAGGAGTTCCCAGATGC	152	AY262752	Mohammed et al. (2007)
	Reverse	CGTCTTGCTTGGCTCTTTATAG
IL-18	Forward	AGGTGAAATCTGGCAGTGGAAT	94	AJ276026	Beeckman et al. (2010)
	Reverse	ACCTGGACGCTGAATGCAA

Figure 1. Viability of chicken macrophages 24 h after exposure to 0 to 10 ng/ml T-2. Results expressed as mean±standard deviation of six replicates. *Significant difference compared with the control (0 ng/ml).

Figure 2. Phagocytosis of A. fumigatus conidia by chicken macrophages exposed to 0 to 5 ng/ml T-2 determined 1 h post conidial infection. Results expressed as mean±standard deviation of four replicates. *Significant difference compared with the control (0 ng/ml).

Figure 3. Germination rate of A. fumigatus conidia associated with chicken macrophages exposed to 0 to 5 ng/ml T-2 determined 7 h post conidial infection. Results expressed as mean±standard deviation of four replicates. *Significant difference compared with the control (0 ng/ml).

Figure 4. Transcription level of cytokine mRNA in chicken macrophages during 20 h after infection with A. fumigatus conidia. Data represent the normalized transcription level of a cytokine in the infected macrophages relative to that in the uninfected macrophages (control), which is considered one. Results expressed as mean±standard deviation of three replicates. *Significant difference compared with the control.

Figure 5. Transcription level of cytokine mRNA in chicken macrophages exposed to T-2 (at 1, 2 and 5 ng/ml) determined 6 h after infection with A. fumigatus conidia. Data represent the normalized transcription level of a cytokine in the T-2-exposed macrophages relative to that in the non-T-2-exposed macrophages (control), which is considered one. Results expressed as mean±standard deviation of three replicates. Columns marked 0, 1, 2 and 5 indicate a significant difference from control and macrophages exposed to 1 ng/ml, 2 ng/ml, and 5 ng/ml T-2, respectively.

Lu, Y., Sarson, A.J., Gong, J., Zhou, H., Zhu, W., Kang, Z., Yu, H., Sharif, S. & Han, Y. (2009). Expression profiles of genes in toll-like receptor-mediated signaling of broilers infected with Clostridium perfringens. Clinical and Vaccine Immunology, 16, 1639–1647.

 PubMed Web of Science ®Google Scholar

Mohammed, J., Frasca, S. Jr., Cecchini, K., Rood, D., Nyaoke, A.C., Geary, S.J. & Silbart, L.K. (2007). Chemokine and cytokine gene expression profiles in chickens inoculated with Mycoplasma gallisepticum strains Rlow or GT5. Vaccine, 25, 8611–8621.

 PubMed Web of Science ®Google Scholar

Hong, Y.H., Lillehoj, H.S., Lee, S.H., Dalloul, R.A. & Lillehoj, E.P. (2006). Analysis of chicken cytokine and chemokine gene expression following Eimeria acervulina and Eimeria tenella infections. Veterinary Immunology and Immunopathology, 114, 209–223.

 PubMed Web of Science ®Google Scholar

Beeckman, D.S.A., Rothwell, L., Kaiser, P. & Vanrompay, D.C.G. (2010). Differential cytokine expression in Chlamydophila psittaci genotype A-, B- or D-infected chicken macrophages after exposure to Escherichia coli O2:K1 LPS. Developmental and Comparative Immunology, 34, 812–820.

 PubMed Web of Science ®Google Scholar