Generation of a safe Salmonella Gallinarum vaccine candidate that secretes an adjuvant protein with immunogenicity and protective efficacy against fowl typhoid

Figures & data

Table 1. Bacterial strains and plasmids used in this study.

Strain or plasmid	Description	Reference
Strain
E. coli
JOL500	Wild-type F18^+, LT^+, STa^+, STb^+, stx2^+, stx2e^+ ETEC isolate from pig	Hur & Lee (2011)
S. Gallinarum
JOL394	Wild-type isolate from chicken	Matsuda et al. (2010)
JOL916	▵lon▵cpxR, a derivative of JOL394	Matsuda et al. (2010)
JOL967	▵lon▵cpxR▵asd, a derivative JOL916	Jeon et al. (2012)
JOL967-JHL80	JOL967 harbouring pJHL80	Present study
JOL1355	JOL967 harbouring pJHL80-LTB	Present study
JOL422	Wild-type challenge strain isolated from chicken	Matsuda et al. (2011)
Plasmid
pBR322	Cloning vector; Ap^rTc^r	Bolivar et al. (1977)
pJHL80	Asd^+ vector, p15A ori, β-lactamase signal sequence-based periplasmic secretion plasmid, 6 × His	Present study
pJHL80-LTB	pJHL80 derivative harbouring eltB	Present study

Table 2. Primers used in this study.

Primer	Primer sequence (5′ to 3′)	Source
asd-F	CGGAAATGATTCCCTTCCTAACG	Kang et al. (2002)
asd-R	TATCTGCGTCGTCCTACCTTCAG
eltB-F	CCGCGAATTCGCTCCCCAGTCTATTACAG	Hur & Lee (2011)
eltB-R	CCGCAAGCTTCTAGTTTTCCATACTGATTG
OMPC-F	ATCGCTGACTTATGCAATCG	Alvarez et al. (2004)
OMPC-R	CGGGTTGCGTTATAGGTCTG
SG-F	GATCTGCTGCCAGCTCAA	Kang et al. (2011)
SG-R	GCGCCCTTTTCAAAACATA
lon-both-F	ATTTTATCTCCCCTTTCGTTTTTC	Jeon et al. (2012)
lon-both-R	CTGCCAGCCCTGTTTTTATTAGC
cpxR-both-F	CAGCGCCAGCGTCAACCAGAAGAT	Jeon et al. (2012)
cpxR-both-R	GAGGCCATAACAGCAGCGGTAACT
LTB-F	GCTCCCCAGTCTATTACAG	Hur & Lee (2011)
LTB-R	CTAGTTTTCCATACTGATTG

Figure 1. Detection of the LTB adjuvant protein by western blot assay. The LTB protein expressed and secreted by JOL1355 was identified by immunoblotting with anti-His-tagged monoclonal antibody. JOL967 containing pJHL80 only was used as a negative control. Lane M, protein marker; lane 1, negative control; lane 2, LTB protein from JOL1355. Arrow indicates LTB protein expression from JOL1355 in lane 2.

Figure 2. Plasma IgG and intestinal sIgA immune responses against an SG-specific OMP antigen in chickens immunized with the LTB-secreting Salmonella Gallinarum vaccine candidate, JOL1355. Values represent the mean ± standard deviation (ng/ml). *Significant differences between the values of the immunized group and those of the control group (P ≤ 0.05).

Figure 3. Plasma IgG and intestinal sIgA immune responses against LTB antigen in chickens immunized with the LTB-secreting Salmonella Gallinarum vaccine candidate, JOL1355. Values represent the mean ± standard deviation (ng/ml). *Significant differences between the values of the immunized group and those of the control group (P ≤ 0.05).

Figure 4. Stimulation index of chicken lymphocyte samples from the peripheral lymphocyte proliferation assay using soluble antigen at the fourth week post immunization. *Significant differences between the values of the immunized group and those of the control group (P ≤ 0.05).

Figure 5. Flow cytometric analysis of CD3⁺CD4⁺ and CD3⁺CD8⁺ T-cell populations at the seventh day post immunization. 5a: Flow cytometry scatter dot plots for CD3⁺, CD4⁺, CD8⁺ T-cell populations. Plots represent events for one representative sample from each group. 5b: Bar graph representing the populations of CD3⁺CD4⁺ and CD3⁺CD8⁺ T cells in peripheral blood samples of control and immunized groups. Statistical significance defined at P ≤ 0.05. *P ≤ 0.05 versus PBS inoculated control. APC, allophycocyanin; FITC, fluorescein isothiocyanate; PE, phycoerythrin.

Figure 6. Survival rates in chickens of the immunized and control groups challenged with the wild-type Salmonella Gallinarum JOL422. All chickens in each group were orally challenged with 100 µl bacterial suspension containing 1 × 10⁶ CFU JOL422 at 4 weeks post immunization. Chickens showed mortality from day 7 post challenge.

Hur, J. & Lee, J.H. (2011). Enhancement of immune responses by an attenuated Salmonella enterica serovar Typhimurium strain secreting an Escherichia coli heat-labile enterotoxin B subunit protein as an adjuvant for a live Salmonella vaccine candidate. Clinical Vaccine Immunology, 18, 203–209. 10.1128/CVI.00407-10

 PubMed Web of Science ®Google Scholar

Matsuda, K., Chaudhari, A.A., Kim, S.W., Lee, K.M. & Lee, J.H. (2010). Physiology, pathogenicity and immunogenicity of lon and/or cpxR deleted mutants of Salmonella Gallinarum as vaccine candidates for fowl typhoid. Veterinary Research, 41, 59. 10.1051/vetres/2010031

 PubMed Web of Science ®Google Scholar

Jeon, B.W., Jawale, C.V., Kim, S.H. & Lee, J.H. (2012). Attenuated Salmonella Gallinarum secreting an Escherichia coli heat-labile enterotoxin B subunit protein as an adjuvant for oral vaccination against fowl typhoid. Veterinary Immunology and Immunopathology, 150, 149–160. 10.1016/j.vetimm.2012.09.006

 PubMed Web of Science ®Google Scholar

Matsuda, K., Chaudhari, A.A. & Lee, J.H. (2011). Evaluation of safety and protection efficacy on cpxR and lon deleted mutant of Salmonella Gallinarum as a live vaccine candidate for fowl typhoid. Vaccine, 29, 668–674. 10.1016/j.vaccine.2010.11.039

 PubMed Web of Science ®Google Scholar

Bolivar, F., Rodriguez, R.L., Greene, P.J., Betlach, M.C., Heyneker, H.L., Boyer H.W., Crosa, J.H. & Falkow, S. (1977). Construction and characterization of new cloning vehicles. II. A multipurpose cloning system. Gene, 2, 95–113. 10.1016/0378-1119(77)90000-2

 PubMed Web of Science ®Google Scholar

Kang, H.Y., Srinivasan, J. & Curtiss, R. (2002). Immune responses to recombinant pneumococcal PspA antigen delivered by live attenuated Salmonella enterica serovar Typhimurium vaccine. Infection and Immunity, 70, 1739–1749. 10.1128/IAI.70.4.1739-1749.2002

 PubMed Web of Science ®Google Scholar

Alvarez, J., Sota, M., Vivanco, A.B., Perales, I., Cisterna, R., Rementeria, A. & Garaizar, J. (2004). Development of a multiplex PCR technique for detection and epidemiological typing of Salmonella in human clinical samples. Journal of Clinical Microbiology, 42, 1734–1738. 10.1128/JCM.42.4.1734-1738.2004

 PubMed Web of Science ®Google Scholar

Kang, M.S., Kwon, Y.K., Jung, B.Y., Kim, A., Lee, K.M., An, B.K., Song, E.A., Kwon, J.H. & Chung, G.S. (2011). Differential identification of Salmonella enterica subsp. enterica serovar Gallinarum biovars Gallinarum and Pullorum based on polymorphic regions of glgC and speC genes. Veterinary Microbiology, 147,181–185. 10.1016/j.vetmic.2010.05.039

 PubMed Web of Science ®Google Scholar