Molecular typing of avian pathogenic Escherichia coli colonies originating from outbreaks of E. coli peritonitis syndrome in chicken flocks

Figures & data

Table 1. Mortality in flocks of laying chickens with EPS from which E. coli colonies were subjected to PFGE and MLST genotyping.

Farm	Flock^a	Breed	Housing	Flock size^b	Period of increased mortality^c	Mortality (norm)^d
A	1^e	Brown layers	Cage	51,932	41 to 57	4.3 (1.6)
B	1^f	White layers	Floor	26,646	80 to 106^g	14.1 (3.8)^h
C^i	1	Brown layers	Free range	15,826	40 to 73^g	18.0 (5.8)
	2^j	Brown layers	Free range	15,547	36 to 77^g	19.8 (3.4)
D	1	Broiler breeders	Floor	13,890	24 to 57^g	22.5 (6.8)
	2^j	Broiler breeders	Floor	13,680	25 to 59^g	13.9 (7.0)

^a Only Flock D1 was medicated and only Flock D2 was vaccinated: medication and vaccination are described under “Experimental design, farms and flocks”. ^bAt 20 weeks of age except for Farm B, for which flock size at 75 weeks of age is given. ^cExpressed as age of birds in weeks. ^dCumulative mortality during the period of increased mortality in percentage of the number of birds at 20 weeks; for Farm B the number of birds at 75 weeks is used. ^eAt 54 weeks of age 10,560 hens of this flock were sold and removed. ^fFlock was moulted at 70 weeks of age. ^gThe latter age represents the end of the production period. ^hNorm dates from 2002 and concerned white layers housed in cages; recent data are not available. ⁱOrganic, multiple-age farm. ^jFlock was allocated to the same house as the previous flock on this farm included in the present study.

Table 2. Results of gross post-mortem examination and bacteriology of dead hens originating from chicken flocks with EPS.

					Macroscopic lesions						Cause of death
Farm	Flock^a	Age at sampling (weeks)	n^b	Productive ovary	Peritonitis	Salpingitis	Airsacculitis	Pericarditis	Perihepatitis	E. coli isolated from bone marrow	EPS	Other
A	1	42	15	13	10	0	10	6	7	14	14	1
B	1	82	18	10	18	0	0	2	3	17	18	0
C	1	56	19	17	14	4	2	0	0	19	19	0
	2^c	41	12	10	10	0	3	4	3	9	11	1
D	1	33	25	23	21	0	0	0	0	18	23	2
	2^c	28	13	9	9	0	0	0	0	13	13	0

Except for “flock and age at sampling”, all figures refer to number of birds. ^aBreed and housing of flocks are presented in Table 1. ^bNumber of hens examined per flock; birds originated from one house and were necropsied within 24 h after dying. ^cFlock was allocated to the same house as the previous flock on this farm included in the present study.

Table 3. Number and prevalence of E. coli PFGE genotypes in chicken flocks with EPS.

				E. coli colonies per genotype (%)^c
Farm	Flock^a	Number of hens with EPS from which E. coli colonies were examined by PFGE^b	Number of genotypes	1	2	3	4	5
A	1	9^d	3	7 (78)	1 (11)	1 (11)
B	1	10	2	7 (70)	3 (30)
C	1	16^d,e	4	7 (44)	7 (44)	1 (6)	1 (6)
	2^f	9	5	4 (44)	2 (22)	1 (11)	1 (11)	1 (11)
D	1	10	3	7 (70)	2 (20)	1 (10)
	2^f	13^g	1	13 (100)

^a Breed and housing of flocks are presented in Table 1. ^bOne colony was examined per hen to study genetic diversity within and between flocks; moreover, five colonies were examined to study clonality within birds. E. coli bacteria were always clonal within hens. ^cGenotypes differ between flocks except in Flocks C1 and C2, which share three genotypes. ^dNine colonies will enable the detection of an E. coli genotype with 95% confidence if the genotype is present at a prevalence of ≥28%, while with 16 colonies a genotype prevalence of ≥18% will be found with 95% confidence (Johnson et al., 2004). ^eClonality within birds was examined in 14 hens. ^fFlock was allocated to the same house as the previous flock on this farm included in the present study. ^gClonality within birds was examined in 12 hens.

Table 4. Target genes, primer name, primer sequence and product size of the seven housekeeping genes used for multilocus sequence typing of E. coli (Wirth et al., 2006) isolated from the bone marrow of hens with EPS.

Target genes	Primer name	Primer sequence (5′ to 3′)	Product size (base pairs)
adk (adenylate kinase)	adkF	ATTCTGCTTGGCGCTCCGGG	583
	adkR	CCGTCAACTTTCGCGTATTT
fumC (fumarate hydratase)	fumCF	TCACAGGTCGCCAGCGCTTC	806
	fumCR	GTACGCAGCGAAAAAGATTC
gyrB (DNA gyrase)	gyrBF	TCGGCGACACGGATGACGGC	911
	gyrBR	ATCAGGCCTTCACGCGCATC
icd (isocitrate/isopropylmalate dehydrogenase)	icdF	ATGGAAAGTAAAGTAGTTGTTCCGGCACA	878
	icdR	GGACGCAGCAGGATCTGTT
mdh (malate dehydrogenase)	mdhF	ATGAAAGTCGCAGTCCTCGGCGCTGCTGGCGG	932
	mdhR	TTAACGAACTCCTGCCCCAGAGCGATATCTTTCTT
purA (adenylosuccinate dehydrogenase)	purAF	CGCGCTGATGAAAGAGATGA	816
	purAR	CATACGGTAAGCCACGCAGA
recA (recombinase A)	recAF	CGCATTCGCTTTACCCTGACC	780
	recAR	TCGTCGAAATCTACGGACCGGA^a

^a Primer updated from the University of Warwick website (http://mlst.warwick.ac.uk/mlst/dbs/Ecoli/documents/primersColi_html).

Figure 1. PFGE dendrogram and corresponding DNA fragment patterns of 45 E. coli colonies obtained from the bone marrow of nine hens with EPS belonging to the same flock (Farm A). Colonies from a single hen (five colonies per hen) were always clonal; however, this was not the case between hens. In this flock, three genotypes were found. Additional colonies of the years 2005 and 2009 from other EPS cases were included.

Figure 2. PFGE dendrogram and corresponding DNA fragment patterns of 25 E. coli colonies obtained from the bone marrow of single hens with EPS from two successive flocks of Farm C (Flocks 1 and 2). Most colonies of the second flock belonged to genotype 1 or 2 that also dominated in the previous flock. Additional colonies of the years 2005 and 2009 from other EPS cases were included.

Figure 3. PFGE dendrogram and corresponding DNA fragment patterns of 23 E. coli colonies obtained from the bone marrow of single hens with EPS from two successive flocks of Farm D (Flocks 1 and 2). Genotypes found in the second flock were unrelated to those of the previous one. Additional colonies of the years 2005 and 2009 from other EPS cases were included.

Figure 4. PFGE dendrogram and corresponding DNA fragment patterns of 67 E. coli colonies obtained from the bone marrow of single hens with EPS from six flocks. In total, 15 genotypes were found. Additional colonies of the years 2005 and 2009 from other EPS cases were included.

Figure 5. Minimum spanning tree of 63 E. coli colonies obtained from the bone marrow of hens with EPS analysed by MLST. Clustering of MLST profiles was done using a categorical coefficient. Sequence types are displayed as circles. The size of each circle is proportional to the number of E. coli colonies with a particular ST. Inside the circles the coloured area reflects the number of colonies from each collection. Short fat lines connect strains that are different in one single locus. The longer thin line connects double locus variants. Strains that were different in three or more loci are not connected. STs and CCs were assigned using the University of Warwick database. CCs are presented when strains are different in one locus. The shaded grey area around STs denotes types that belong to the same CC, and known CCs are also indicated with a CC and number.

Table 5. PFGE type, farm, flock, allele numbers, sequence type and clonal complex of 24 E. coli colonies obtained from the bone marrow of hens with EPS analysed by multilocus sequence typing.

PFGE type	Farm	Flock	adk	fumC	gyrB	icd	mdh	purA	recA	ST	CC
1	A	1	13	40	13	13	23	311	66	4109	–^a
2	D	2	6	4	12	1	20	13	7	23	23
	D	2	6	4	12	1	20	13	7	23	23
3	B	1	6	152	4	10	7	8	6	2535	–
	B	1	6	152	4	10	7	8	6	2535	–
4	A	1	13	52	10	14	17	25	17	141	–
5	D	1	96	40	13	100	23	28	66	428	–
	D	1	96	40	13	100	23	28	66	428	–
6	B	1	97	40	93	13	23	28	66	429	–
	B	1	97	40	93	13	23	28	66	429	–
7	C	2	6	4	4	18	24	5	14	56	155
8	C	1	37	38	19	37	17	11	26	95	95
	C	1	37	38	19	37	17	11	26	95	95
9	D	1	37	38	19	37	17	11	26	95	95
10	A	1	37	38	19	37	17	11	26	95	95
	A	1	37	38	19	37	17	11	26	95	95
11	C	1	43	41	266	18	11	7	6	4359^b	–
12	C	1	37	38	19	37	17	11	26	95	95
	C	2	37	38	19	37	17	11	26	95	95
13	C	1	6	31	5	28	1	1	2	57	350
	C	2	6	31	5	28	1	1	2	57	350
14	C	2	6	95	4	88	7	7	7	351	–
15	D	1	20	45	41	43	5	32	2	117	–
	D	1	20	45	41	43	5	32	2	117	–

^a ST not assigned to a CC. ^bNew ST submitted to the database with strain identification Chicken/NL/Dev/SP01390Mhe/11.

Johnson, W.O., Su, C.L., Gardner, I.A. & Christensen, R. (2004). Sample size calculations for surveys to substantiate freedom of populations from infectious agents. Biometrics, 60, 165–171. 10.1111/j.0006-341X.2004.00143.x

 PubMed Web of Science ®Google Scholar

Wirth, T., Falush, D., Lan, R., Colles, F., Mensa, P., Wieler, L.H., Karch, H., Reeves, P.R., Maiden, M.C., Ochman, H. & Achtman, M. (2006). Sex and virulence in Escherichia coli: an evolutionary perspective. Molecular Microbiology, 60, 1136–1151. 10.1111/j.1365-2958.2006.05172.x

 PubMed Web of Science ®Google Scholar