Hsp90 inhibitor celastrol reinstates growth plate angiogenesis in thiram-induced tibial dyschondroplasia

Figures & data

Table 1. Primers used for qPCR analysis.

Gene	Gene description	Primer sequence (5′–3′)	Product length (B.P)	Tm °C
GAPDH	NM_204305.1	GCCCAGAACATCATCCCA CGGCAGGTCAGGTCAACA	137	58
Hsp90	NM_001109785.1	CTGTGAGGAACTGATCCCCG TTGCGGTTCTGGGAGTCTTC	252	59
VEGF	NM_205042.2	CGATGAGGGCCTAGAATGTGTC AGCTCATGTGCGCTATGTGC	101	55
Flk-1	AB066660.1	GGAGTTTCCCAGAGACCGAC CAATCCCAAAGGCATCAGC	89	64

Figure 1. The effect of celastrol on thiram-induced TD (growth-plate width and morphology). Tibiotarsus growth plates were compared at the ages of 7 and 14 days before and after celastrol administration. Enlarged growth plate in the chicks with TD; the normal growth plate size after celastrol treatment with a decrease in growth plate width. AC, articular cartilage; GP, growth plate; TD, Tibial dyschondroplasia.

Table 2. Growth plate lesion size and TD score in control, thiram-induced and celastrol-treated groups. The results are expressed as means ± SE (n = 10).

Day 7	Length (mm)	TD score	Day 14	Length (mm)	TD score
Control	0.96 ± 0.05^a	0	Control	0.84 ± 0.04^a	0
Thiram	1.67 ± 0.06^b	1	Thiram	2.8 ± 0.08^b	2
			Celastrol	0.99 ± 0.04^a	0

Note: Chicks with scores 0 were designated as normal, 1 as mild pathology, while those with scores 2 were regarded as severe pathology. ^a,bRepresent significant difference (P < 0.05) in columns.

Figure 2. Samples were collected, then tibial growth plates were stained with haematoxylin and eosin. Growth plate of TD-affected chicks was less vascularized and the columnar arrangement of the chondrocytes was lost. After celastrol administration, the columnar organization in growth plate was restored with developing blood vessels (Arrows (→) represent the BV) in the hypertrophic area (Bar = 200 µm).

Figure 3. Effect of inhibition of Hsp90 activity with celastrol was analysed by reverse transcription qPCR on days 7 and 14 (A).Results are expressed in arbitrary units, data represent the mean ± SE (n = 4 each group). Results are shown relative to mRNA expression levels from the control group. Control group is set to one to compare the n-fold difference, letters ^abc indicate significant differences (P < 0.05). Western blot analysis on day 7 (B) and day 14 (C) of normal, TD-affected and celastrol treated growth plate. Western blot analysis shows the band conforming to the Hsp90 and membranes were also probed with β-actin antibody (loading control) to confirm that equal amounts of proteins were loaded; band a, control; band b, TD-affected; band c, celastrol administration.

Figure 4. Real-time quantitative PCR analysis of VEGF and FLK-1 on day 7 (a) and day 14 (b), quantification of gene amplification was done using the Ct values, all expression levels were normalized using the reference gene GAPDH. Results are shown as mean ± SE (n = 4 each group), Control group set to one thus to compare the N-fold difference. ^abindicate significant differences (P < 0.05).

Table 3. The effect of thiram (40 mg/kg) and celastrol (4 mg/kg/d) on ALT, AST and ALP activities, Values (mean ± SD) were compared by one way ANOVA.

Days post-hatch	Control (n = 20)	Thiram (n = 20)	Celastrol (n = 20)
ALT (U/l)
10	31.18 ± 0.9b	68.51 ± 3.3a	64.42 ± 1.8a
14	41.62 ± 1.6b	93.32 ± 2.2a	45.08 ± 0.6b
AST (U/l)
10	54.35 ± 1.3b	130.74 ± 1.3a	96.27 ± 1.2a
14	62.11 ± 1.8b	150.11 ± 2.6a	65.23 ± 1.6b
ALP (U/l)
10	134.28 ± 0.7a	107.41 ± 0.5b	128.32 ± 2.1a
14	150.89 ± 1.7a	72.2 ± 0.3b	143.29 ± 0.7a

Note: Different letters (ab) represent a level of significance (P < 0.05) in rows.

Table 4. Effect of celastrol (4 mg/kg/d) on SOD, GSH-Px activities and MDA contents on 14 days post-hatch, Values (mean ± SD) were compared by one way ANOVA.

Parameter	Control (n = 20)	Thiram (n = 20)	Celastrol (n = 20)
SOD (U/mg)	132.1 ± 1.5a	90.7 ± 1.6b	125.37 ± 1.2a
GSH-Px (U/mg)	22.52 ± 0.8a	12.26 ± 0.2b	20.03 ± 0.5a
MDA (nmoles/g)	28.5 ± 0.9b	42.8 ± 1.2a	30.7 ± 1.3b

Note: Different letters (ab) represent levels of significance (P < 0.05) in rows.