Exogenous IAA enhances low potassium tolerance of sweetpotato by regulating root response strategy

Figures & data

Table 1. Effects of exogenous IAA on biomass of sweetpotato under different K⁺ levels.

Variety	Treatment	Shoot dry mass (g/plant)	Root dry mass (g/plant)	Total dry mass (g/plant)
XS32	Control	0.96 ± 0.04 a	0.31 ± 0.01 b	1.27 ± 0.04 b
	Control+IAA	0.99 ± 0.03 a	0.35 ± 0.01 a	1.34 ± 0.03 a
	LK	0.76 ± 0.02 c	0.23 ± 0.02 d	0.99 ± 0.02 d
	LK+IAA	0.87 ± 0.04 b	0.28 ± 0.02 c	1.15 ± 0.03 c
NZ1	Control	1.00 ± 0.04 a	0.29 ± 0.02 a	1.28 ± 0.02 b
	Control+IAA	1.03 ± 0.02 a	0.32 ± 0.02 a	1.34 ± 0.01 a
	LK	0.68 ± 0.03 c	0.18 ±0 .01 b	0.86 ± 0.03 d
	LK+IAA	0.75 ± 0.01 b	0.20 ± 0.02 b	0.95 ± 0.02 c

Data are means ± standard deviation (n = 3), means within the same column followed by different letters (a, b and c, etc.) are significantly different between treatments on the same day (P < 0.05, Duncan’s test). The same label applies to Table 3.

Table 2. Effects of exogenous IAA on K⁺ content and accumulation of sweetpotato under different K⁺ levels.

Variety	Treatment	K^+ content (%)		K^+ accumulation (mg/plant)
		Shoot	Root	Shoot	Root	Total
XS32	Control	3.25 ± 0.23 b	3.36 ± 0.09 b	31.09 ± 1.14 b	10.53 ± 0.19 b	41.62 ± 1.31 b
	Control+IAA	3.70 ± 0.29 a	4.19 ± 0.28 a	36.51 ± 0.93 a	14.67 ± 0.42 a	51.17 ± 1.23 a
	LK	2.45 ± 0.18 c	1.19 ± 0.04 c	18.70 ± 0.37 d	2.70 ± 0.08 d	21.40 ± 0.39 d
	LK+IAA	2.67 ± 0.04 c	1.28 ± 0.09 c	23.31 ± 0.97 c	3.61 ± 0.23 c	26.93 ± 0.82 c
NZ1	Control	3.06 ± 0.08 a	4.79 ± 0.34 a	30.50 ± 1.24 b	13.73 ± 1.00 a	44.23 ± 0.36 b
	Control+IAA	3.27 ± 0.15 a	4.60 ± 0.15 a	33.57 ± 0.50 a	14.57 ± 0.96 a	48.14 ± 0.46 a
	LK	1.83 ± 0.24 b	2.00 ± 0.10 b	12.50 ± 0.46 d	3.53 ± 0.12 b	16.04 ± 0.56 d
	LK+IAA	2.00 ± 0.09 b	2.04 ± 0.11 b	14.93 ± 0.12 c	4.15 ± 0.31 b	19.08 ± 0.41 c

Table 3. Sequence of primers for ARF and related genes used for qRT-PCR.

Gene name	Function classification	Forward primer	Reverse primer
ARF	Reference gene	CTTTGCCAAGAAGGAGATGC	TCTTGTCCTGACCACCAACA
IbYUC6	IAA synthesis	ACACGCATGGACTATAGGAGAG	GCCACCCCTTTCTCCTTCAA
IbTAR2	IAA synthesis	GTACCGGAAGCTGTGTTTGC	TCCGCCATGCATCAGCTTAA
IbPIN1	Auxin carrier	CCCAGAAGCAAGCAGAGGAA	CACTTGGTTGGAAGCACAGC
IbPIN3	Auxin carrier	TGGCATGATCTTTACGTCGT	GGCGACAAAACGGTTGATCC
IbPIN8	Auxin carrier	TCCCTAGCCGATGTCTACCA	GCAAGCGAGAAGTTTTTGAAGG

Figure 1. Effects of exogenous IAA on endogenous IAA content in leaves (a and b) and roots (c and d) of sweetpotato under different K⁺ levels. Data are means ± standard deviation (n = 3), different letters (a, b and c, etc.) on columns indicate significant differences between treatments on the same day (P < 0.05, Duncan’s test).

Figure 2. Effects of exogenous IAA on total root morphology of sweetpotato under different K⁺ levels. (a and b) total root length; (c and d) root forks number; (e and f) root crossings number. Data are means ± standard deviation (n = 3), different letters (a, b and c, etc.) on columns indicate significant differences between treatments on the same day (P < 0.05, Duncan’s test).

Figure 3. Effects of exogenous IAA on lateral root characteristics of sweetpotato under different K⁺ levels. (a and b) lateral root length; (c and d) lateral root ratio; (e and f) lateral root density. Data are means ± standard deviation (n = 3), different letters (a, b and c, etc.) on columns indicate significant differences between treatments on the same day (P < 0.05, Duncan’s test).

Figure 4. Effects of exogenous IAA on expression levels of auxin biosynthesis genes of sweetpotato under different K⁺ levels. (a, b, e and f) expression of IbYUC6; (c, d, g and h) expression of IbTAR2. Data are means ± standard deviation (n = 3),different letters (a, b and c, etc.) on columns indicate significant differences between treatments on the same day (P < 0.05, Duncan’s test).

Figure 5. Effects of exogenous IAA on expression levels of auxin transport genes in leaves of sweetpotato under different K⁺ levels. (a and b) expression of IbPIN1; (c and d) expression of IbPIN3;(e and f) expression of IbPIN8. Data are means ± standard deviation (n = 3), different letters (a, b and c, etc.) on columns indicate significant differences between treatments on the same day (P < 0.05, Duncan’s test).

Figure 6. Effects of exogenous IAA on expression levels of auxin transport genes in roots of sweetpotato under different K⁺ levels. (a and b) expression of IbPIN1; (c and d) expression of IbPIN3;(e and f) expression of IbPIN8. Data are means ± standard deviation (n = 3), different letters (a, b and c, etc.) on columns indicate significant differences between treatments on the same day (P < 0.05, Duncan’s test).