Scanning electron microscopy and in vitro cultivation of endophytic bacteria from potato tubers afflicted with zebra chip disease

Figures & data

Fig. 1. Cross-sections of potato tubers used in this study. Healthy (non-ZCD) and exhibiting zebra chip disease symptoms (ZCD). Zebra chip diseased tubers were subsequently all confirmed to be PCR-positive for ‘Candidatus Liberibacter solanacearum’.

Table 1.  Primer sets and their properties used in this study

Primer set (Forward /Reverse)	Sequence (5′– 3′)	Ampliconsize (bp)	Targeted bacteria	Reference
E8F/E1544R	AGAGTTTGATCCTGGCTCAG/AAGGAGGTGATCCANCCRCA	1536	All eubacteria	Baker et al. (2003)
E9F/E1115R	GAGTTTGATCCTGGCTCAG/AGGGTTGCGCTCGTTG	1106	All eubacteria	Baker et al. (2003)
E334F/E1115R	CCAGACTCCTACGGGAGGCAGC/AGGGTTGCGCTCGTTG	780	All eubacteria	Baker et al. (2003)
Paeni-F2/Paeni-R2	AATGTGTTAACTTCGGCACCA/AGCGTTGTCCGGAATTATTG	325	Paenibacillus sp.	This study
Microb-F2/Microb-R2	TAATGCGTTAGCTGCGTCAC/AGAGTGCGGTAGGGGAGATT	222	Microbacterium sp.	This study
Brach-F/Brach-R	CGGCCTATCAGTTTGTTGGT/GAATGTCGCCCACACCTAGT	588	Brachybacterium sp.	This study
Staph-F1/Staph-R1	CCATGTGTAGCGGTGAAATG/TAAGGTTCTTCGCGTTGCTT	306	Staphylococcus sp.	This study
Bosea-F/Bosea-R	AAACCGGACATGTCAAAAGC/TGGTGGAACTGCGAGTGTAG	337	Bosea sp.	This study

Fig. 2. Scanning electron micrographs of phloem tissue of potato tubers with zebra chip disease. (A) Clumps of bacilli bacteria; (B) Bacilli bacteria of different sizes (arrows); (C) Cocci or cocci-like bacteria; and (D) Chain-like structure of bacterial cells (arrow).

Table 2.  Comparison of taxonomic distribution of endophytic bacteria from potato tubers

	GenBank accession	Non-ZCD	ZCD
α-proteobacteria group		(6)	(2)
Bosea sp. Das	KC684431	3	0
Brachybacterium sp. Collins	KC684432	0	2
Sphingomonas sp. Takeuchi	KC684433	2	0
Sphingopyxis sp. Takeuchi	KC684434	1	0
β-proteobacteria group		(0)	(1)
Variovorax sp. Willems	−^a	0	1
γ-proteobacteria group		(2)	(8)
Acinetobacter sp. Brisou & Prévot	KC684435	2	6
Enterobacter sp. Hormaeche & Edwards	KC684436	0	1
Stenotrophomonas sp. Palleroni	KC684437	0	1
Firmicutes group		(17)	(15)
Bacillus sp. Cohn	KC684438	17	6
Paenibacillus sp. Ash	KC684439	0	7
Staphylococcus sp. Rosenbach	KC684440	0	2
Actinobacteria group		(7)	(20)
Arthrobacter sp. Conn & Dimmick	KC684441	1	2
Microbacterium sp. Orla-Jensen	KC684442	0	6
Mycobacterium sp. Lehmann & Neumann	KC684443	3	10
Nocardia sp. Trevisan	KC684444	1	0
Tsukamurella sp. Collins	KC684445	2	2
Unidentified bacteria		(2)	(4)
^a The sequence was 188 bp and not submitted to GenBank.

Fig. 3. PCR amplification of potato endophytic bacteria previously determined to be ZCD-only and non-ZCD-only from potato tubers by in vitro cultivation method. PCR primer sets from each bacterium yielded amplicons from both ZCD and non-ZCD-tubers. Primer information is listed in Table 1.

Baker , G.C. , Smith , J.J. and Cowan , D.A. 2003 . Review and re-analysis of domain-specific 16S primers . J. Microbiol. Meth. , 55 : 541 – 555 .

 PubMed Web of Science ®Google Scholar