Identification of bacterial pathogens and races of Pseudomonas syringae pv. phaseolicola from dry bean fields in Western Canada

Figures & data

Table 1. Primer sets, sequences and amplicon size used to identify bacterial pathogens using single-colony PCR or multiplex PCR using crude plant extracts as the template.

Primer set	Primer sequence (5ʹ -> 3”)	Amplicon size (bp)	Target gene	Species amplified^a	Reference
Ps-Rev/ Ps-For	TTAGCTCCACCTCGCGGC/ GGTCTGAGAGGATGATCAGT	980	16S rRNA	Pseudomonas spp.	Widmer et al. (1998)
HB14F/ HB14R	CAACTCCGACACCAGCGACCGAGC/ CCGGTCTGCTCGACATCGTGCCAC	1400	tox gene cluster	Pph	Audy et al. (1996)
PphE-F/ PphE-R	GCGTTCGATCATAACGTTGA/ TCATTGGCAGAGCGATGAGT	1327	hopX1 (avrPphE)	Pph, all races	Stevens et al. (1998)
PphB-F/ PphB-R	TGGATCCACCATGAAAATAGGTACGC/ TTCGCACTCGAGTGGTAAATATTGCCG	850	hopAR1 (avrPphB)	Pph, races 3, 4	Stevens et al. (1998)
PphF-F/ PphF-R	ATGAAGAATTCGTTCGACCG/ TCAGACCGAACTCTCAGACA	380	hopF1 (avrPphF)	Pph, races 1, 5, 7, 9	Tsiamis et al. (2000)
rpoD-L/ rpoD-R	CGCCAAACGTATCGAAGAA/ GCTATTTTCAGGCCGGTTT	572	rpoD	Pph	Rico et al. (2003)
syrB-F/ syrB-R	TCGATTTTGCCGTGATGAGTC/ CTTTCCGTGGTCTTGATGAGG	750	syrB	Pss	Sorensen et al. (1998)
XgyrB-F/ XgyrB-R	AAGCAGGGCAAGAGCGAGCTGTA/ CAAGGTGCTGAAGATCTGGTC	600	gyrB	Xanthomonas spp.	Parkinson et al. (2007)
Xf1/Xf2	ACGCAAGACCCATCGTCATTC/ ATGGCTCAAGGAAAAACTTTCAGG	450	SCAR^b marker	Xff	Toth et al. (1998)
X4e/X4c	CGCCGGAAGCACGATCCTCGAAG/ GGCAACACCCGATCCCTAAACAG	730	p7 plasmid	Xap	Audy et al. (1996)
CffR/ CffF	GATGTTCCCGGTGTTCAG/ GTTATGACTGAACTTCACTCC	306	ERIC^c-amplified target	Cff	Tegli et al. (2002)

^aPph = P. syringae pv. phaseolicola; Pss = P. syringae pv. syringae; Xff = X. fuscans subsp. fuscans; Xap = X. axonopodis pv. phaseolicola; Cff = C. flaccumfaciens pv. Flaccumfaciens.

^bSCAR = sequence conserved amplified region.

^cERIC = enterobacterial repetitive intragenic consensus.

Fig. 1 (Colour online) Symptoms of bacterial diseases observed during field surveys conducted in Alberta in 2012, with corresponding pathogens isolated from leaves in the lab. (a) Large yellow halos surrounding small necrotic lesions typical of halo blight; Pph isolated; (b) Brown spot symptoms showing spotty brown necrotic lesions with slight yellow margins; Pss isolated. (c) Symptoms typical of brown spot, but both Pph and Pss were isolated; (d) Early symptoms of common blight with brown necrotic area and yellow margins; both Xff and Pph isolated; (e) Foliar symptoms of bacterial wilt with spreading brown, senescent lesions and slight yellow margins; both Cff and Pph were isolated; and (f) symptoms typical of abiotic injury yielding fluorescent Pseudomonads only.

Table 2. Occurrence and severity of bacterial disease symptoms observed during surveys of commercial dry bean fields in southern Alberta.

Year	No. fields surveyed	Severity	No. fields with bacterial blights
2012	44	None^a	5
		Trace	0
		Mild	14
		Moderate	13
		Severe	8
		Very Severe	4
2013	40	None	39
		Trace	0
		Mild	0
		Moderate	1
		Severe	0
		Very Severe	0
2014	45	None	36
		Trace	1
		Mild	3
		Moderate	2
		Severe	1
		Very Severe	2

^aNone: 0% incidence; trace: <1%; mild: 1–10%; moderate: 11–25%; severe: 26–50%; very severe: >50%.

Fig. 2 Change in bacterial blight incidence (a) and severity (b) over the growing season in 2012.

Table 3. Frequency of isolation (%) of bacterial pathogens from bean tissue samples collected in Alberta during 2012 and 2014 using three different identification methods: colony morphology on milk-tween agar, single colony PCR and PCR from plant extract.

	2012			2014
	Colony ID^a	Single colony PCR^b	PCR from plant extract^b	Colony ID	Single colony PCR	PCR from plant extract
Pph	44	40	25	31	31	15
Pss	65	29	25	38	38	31
Xap or Xff	38	5	4	15	0	0
Cff	ND^c	ND	4	ND	ND	0
Fluorescent Pseudomonas spp.	0	42	ND	0	0	ND

^a Presumptive identification based on morphology on milk-tween agar.

^bDiagnostic DNA fragment sizes: Cff (C. flaccumfaciens pv. flaccumfaciens), 300 bp; Pph (P. syringae pv. phaseolicola), 1450 bp; Pss (P. syringae pv. syringae), 790 bp; Xap (X. axonopodis pv. phaseolicola), 750 bp; Xff (X. fuscans subsp. fuscans), 450 bp.

^cND = not done.

Table 4. Identification of Xanthomonas-like bacteria isolated from bean leaf samples using 16S ribosomal sequences and length of lesions on bean stems ‘CDC Sol’ following injection of bacterial suspensions.

Isolate	Identification^a	Lesion length (cm)
LRC 913 Xff^b	Xff	11.5 (0.49)^d
LRC 916 Xap^c	Xap	4.6 (0.46)
M3-74	X. campestris	1.1 (0.46)
M5-77	X. campestris	1.5 (0.46)
M6-78	X. campestris	1.2 (0.46)
M7-79	X. campestris	1.3 (0.46)
M4-74	ND	0.9 (0.46)
M8-79	Pseudomonas sp.	0.9 (0.46)
M1-20	Pseudomonas sp.	1.0 (0.46)
M2-72	Pseudomonas sp.	1.2 (0.46)

^aBased on comparison of approximately 800 base pair rDNA sequences to Ribosomal Database Project sequences (Wang et al. 2007).

^bXff = X. fuscans subsp. fuscans standard from AAFC-Lethbridge culture collection.

^cXap = X. axonopodis pv. phaseolicola standard from AAFC-Lethbridge culture collection.

^dStandard error of the mean.

Table 5. Race characterization of Pseudomonas syringae pv. phaseolicola (Pph) isolates collected from commercial dry bean fields in western Canada in 2011–2014, as determined by reaction on the set of eight differential bean lines.

		Number of isolates
Year	Origin	Tested	Race 2	Race 6	Other races
Pre-2011	Various^a	22	20	2	0
2011	Manitoba	14	6	8	0
2012	Alberta	29	28	1	0
	Manitoba	11	9	2	0
	Saskatchewan	9	9	0	0
2013	Alberta	2	1	1	0
	Manitoba	2	0	2	0
2014	Alberta	17	10	7	0
	Manitoba	8	3	5	0
Total		114	86	28	0

^aIsolates collected prior to 2011 and obtained from culture collections at AAFC-Lethbridge and AAFC-Morden.

Table 6. Response of common blight resistant dry bean breeding lines from the AAFC-Morden bean breeding programme to P. syringae pv. phaseolicola isolate AB2012.002 (race 2) collected in Alberta, as determined in greenhouse trials.

Bean germplasm	Market class	CBB reaction^a	Halo blight severity (1–5)^b
Canadian Wonder	Dark Red Kidney	Susceptible	4.1^c
6-3-2	Navy	Resistant	4.1
Portage	Navy	Resistant	4.1
6-37-1	Navy	Resistant	4.1
5-44-1	Black	Resistant	4.1
5-43-2	Black	Resistant	4.1
5-42-1	Black	Resistant	3.9
H83-39	Navy	Susceptible	3.9
H83-21	Navy	Susceptible	3.9
H83-24	Navy	Susceptible	3.9
4-28-2	Pinto	Resistant	3.8
H83-35	Navy	Susceptible	3.8
4-26-2	Pinto	Resistant	3.8
4-27-1	Pinto	Resistant	3.7
NA06-007-2	Navy	Susceptible	3.6
NA6 27-2	Navy	Susceptible	3.5
Sig(F)			0.117

^aCBB resistant reactions as reported by Boersma et al. (2014).

^bRating scale: 1 = necrosis only in area of inoculation (highly resistant); 2 = trace of water soaking around inoculation (resistant); 3 = more extensive water soaking around inoculation (slightly susceptible); 4 = small lesions distributed over leaf (susceptible); 5 = larger lesions distributed over leaf (fully susceptible) (Innes et al. 1984).

^cData presented were combined from two experiments.

Table 7. Halo blight disease reaction of selected bean genotypes from commonly grown commercial market classes to P. syringae pv. phaseolicola isolate AB2012.002 (race 2) collected in Alberta, as determined in greenhouse trials.

Bean cultivar	Market class	Area grown (ha)^a	Halo blight severity (1–5)^b
CDC Expresso	Black	NG	4.8 ab^c
92 BG-7	Black	Germplasm	4.8 ab
CDC Jet	Black	NG	4.6 bc
I9365-31	Black	Germplasm	2.8 fgh
AC Black Diamond	Black	3759	2.0 i
AAC Black Diamond 2^d	Black		1.8 i
Cran-09	Cranberry	NG	4.1 d
Canadian Wonder	Dark Red Kidney	NG	4.7 ab
Chinook 2000 RRR	Light Red Kidney	NG	4.9 ab
AC Polaris	Great Northern	1737	3.5 e
AAC Whitehorse^d	Great Northern		3.2 f
AC Resolute	Great Northern	15 618	3.1 fg
AAC Tundra^d	Great Northern		2.9 fg
LRS 92–1	Navy	NG	4.9 ab
OAC Rex	Navy	NG	4.1 d
AC Skipper	Navy	NG	3.1 fg
AC Alberta Pink	Pink	NG	4.9 ab
AC Early Rose	Pink	NG	2.8 gh
AC Redbond	Red	1839	2.0 i
Othello	Pinto	Last grown in 2012	5.0 a
Winchester	Pinto	1327	4.1 d
AAC Burdett^d	Pinto		2.5 gh
Medicine Hat	Pinto	2806	2.5 h
AC Island	Pinto	16 456	2.5 h
CDC Sol	Yellow	NG	4.6 bc
Myasi	Yellow	3014	4.4 cd
Arikara Yellow	Yellow	NG	4.0 d
Sig(F)			0.0001

^a Area in which the cultivar was grown in hectares in southern Alberta in 2014 (Agriculture Financial Services Corporation 2015). NG = not grown.

^bRating scale: 1 = necrosis only in area of inoculation (highly resistant); 2 = trace of water soaking around inoculation (resistant); 3 = more extensive water soaking around inoculation (slightly susceptible); 4 = small lesions distributed over leaf (susceptible); 5 = larger lesions distributed over leaf (fully susceptible) (Innes et al. 1984).

^cMeans within a column followed by the same letter are not significantly different (P > 0.05; Duncan’s multiple range test). Data presented are combined over two experiments.

^dCultivars recently registered between 2012 and 2014 that are adapted for production in Alberta.

Widmer F, Seidler RJ, Gillevet PM, Watrud LS, Di Giovanni GD. 1998. A highly selective PCR protocol for detecting 16S rRNA genes of the genus Pseudomonas (sensu stricto) in environmental samples. Appl Environ Microbiol. 64:2545–2553.

 PubMed Web of Science ®Google Scholar

Audy P, Braat CE, Saindon G, Huang HC, Laroche A. 1996. A rapid and sensitive PCR-based assay for concurrent detection of bacteria causing common and halo blights in bean seed. Phytopathology. 86:361–366.

 Web of Science ®Google Scholar

Stevens C, Bennett MA, Athanassopoulos E, Tsiamis G, Taylor JD, Mansfield JW. 1998. Sequence variations in alleles of the avirulence gene avrPphE.R2 from Pseudomonas syringae pv. phaseolicola lead to loss of recognition of the AvrPphE protein within bean cells and a gain in cultivar-specific virulence. Mol Microbiol. 29:165–177.

 PubMed Web of Science ®Google Scholar

Tsiamis G, Mansfield JW, Hockenhull R, Jackson RW, Sesma A, Athanassopoulos E, Bennett MA, Stevens C, Vivian A, Taylor JD, Murillo J. 2000. Cultivar-specific avirulence and virulence functions assigned to avrPphF in Pseudomonas syringae pv. phaseolicola, the cause of bean halo-blight disease. EMBO J. 19:3204–3214.

 PubMed Web of Science ®Google Scholar

Rico A, López R, Asensio C, Aizpún MT, Asensio -S, Manzanera MC, Murillo J. 2003. Nontoxigenic strains of Pseudomonas syringae pv. phaseolicola are a main cause of halo blight of beans in Spain and escape current detection methods. Phytopathology. 93:1553–1559.

 PubMed Web of Science ®Google Scholar

Sorensen KN, Kim K-H, Takemoto JY. 1998. PCR detection of cyclic lipodepsinonapeptide-producing Pseudomonas syringae pv. syringae and similarity of strains. Appl Environ Microbiol. 64:226–230.

 PubMed Web of Science ®Google Scholar

Parkinson N, Aritua V, Heeney J, Cowie C, Bew J, Stead D. 2007. Phylogenetic analysis of Xanthomonas species by comparison of partial gyrase B gene sequences. Int J Syst Evol Microbiol. 57:2881–2887.

 PubMed Web of Science ®Google Scholar

Toth IK, Hyman LJ, Taylor R, Birch PRJ. 1998. PCR-based detection of Xanthomonas campestris pv. phaseoli var. fuscans in plant material and its differentiation from X. c. pv. phaseoli. J Appl Microbiol. 85:327–336.

 Web of Science ®Google Scholar

Tegli S, Sereni A, Surico G. 2002. PCR-based assay for the detection of Curtobacterium flaccumfaciens pv. flaccumfaciens in bean seeds. Lett Appl Microbiol. 35:331–337.

 PubMed Web of Science ®Google Scholar

Wang Q, Garrity GM, Tiedje JM, Cole JR. 2007. Naïve Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy. Appl Environ Microbiol. 73:5261–5267.

 PubMed Web of Science ®Google Scholar

Boersma JG, Conner RL, Balasubramanian PM, Navabi A, Yu K, Hou A. 2014. Combining resistance to common bacterial blight, anthracnose, and bean common mosaic virus into Manitoba-adapted dry bean (Phaseolus vulgaris L.) cultivars. Can J Plant Sci. 94:405–415.

 Web of Science ®Google Scholar

Innes NL, Conway J, Taylor JD. 1984. Resistance to halo-blight in the Cambridge accessions V4604 and V4058 of Phaseolus beans. Ann Appl Biol. 104:307–314.

 Web of Science ®Google Scholar

Agriculture Financial Services Corporation. 2015. Yield Alberta 2015. Supplement to the Alberta Farmer Express, March 2, 2015. Farm Business Communications, Winnipeg Manitoba.

 Google Scholar