Development of a reverse transcription loop-mediated isothermal amplification assay for the rapid detection of Pepper mottle virus

Figures & data

Table 1. Primer set used for RT-LAMP in this study.

Primer	Sequence (5´→3´)
PepMoV-F3	CTTCAATGGCATTTAGAAGCT
PepMoV-B3	CCGTATTGGATCATGTCACAA
PepMoV-FIP(F1C+F2)	GTGAACTCCACCTCTCTGCC-ACACTAATTGTAAGGTTTTGAAGG
PepMoV-BIP(B1C+B2)	ACACAATTCCCAGTGAAATTAGTGG-TTGCTACCTGTGCCTTGA

Fig. 1 Optimization of the reaction conditions used for RT-LAMP to detect PepMoV on an agarose gel. (a) Incubation temperatures: 60ºC, 61ºC, 62ºC, 63ºC, 64ºC, 65ºC and 66ºC. (b) Incubation duration: 30 min, 45 min, 60 min, 75 min, 90 min and 120 min. M indicates the 5 kb DNA ladder (Vazyme). NTC indicates the non-template control.

Fig. 2 Specificity of RT-LAMP for PepMoV detection. Lane 1, PepMoV; Lane 2–3, PVY; Lane 4–5, CRSV; Lane 6–7, ChiVMV; Lane 8–9, PVMV; Lane 10, non-template control. Lane M, 5 kb DNA ladder (Vazyme).

Fig. 3 Sensitivity of RT-LAMP assay for PepMoV detection. (a) RT-LAMP, (b) direct staining with Fluorexon in the reaction tubes, (c) RT-PCR, using serial (10-fold) dilutions of cDNA (Lane 1, 1.47 × 10⁻¹ µg µL⁻¹; Lane 2, 1.47 × 10⁻² µg µL⁻¹; Lane 3, 1.47 × 10⁻³ µg µL⁻¹; Lane 4, 1.47 × 10⁻⁴ µg µL⁻¹; Lane 5, 1.47 × 10⁻⁵ µg µL⁻¹; Lane 6, 1.47 × 10⁻⁶ µg µL⁻¹; Lane 7, 1.47 × 10⁻⁷ µg µL⁻¹; Lane 8, 1.47 × 10⁻⁸ µg µL⁻¹; Lane 9, 1.47 × 10⁻⁹ µg µL⁻¹; NTC, non-template control).

Table 2. Detection of PepMoV in field samples using RT-LAMP and RT-PCR.

Sampling sites	Number of samples collected	Number of samples that tested positive for PepMoV using RT-LAMP	Number of samples that tested positive for PepMoV using RT-PCR
Hunan Province	11	3	3
Guizhou Province	10	3	3
Fujian Province	10	3	3
Guangdong Province	11	2	2
Guangxi Province	27	7	7