Differential gene expression in banana roots in response to Fusarium wilt

Figures & data

Table 1. Details regarding the primers used in this study.

Primer name	Primer sequence (5ʹ – 3ʹ)	Gene
Actin-F	CGAGGCTCAATCAAAGA	Actin (endogenous reference gene)
Actin-R	ACCAGCAAGGTCCAAAC
Cellulose-F	GCTCAACCAGGTGCTACG	Cellulose synthase catalytic subunit 12
Cellulose-R	ACTTGTCGGTGAGGAGGC
Glucosidase-F	AGGCTACGGCAAACTCAG	Periplasmic beta-glucosidase precursor, putative
Glucosidase-R	GACAGGGCCACAAAGAAA
peroxidase N-F	GCTGCTGCTGTTGCTGTAGA	PREDICTED: peroxidase N
peroxidase N-R	TCAAGAACCTGCTGAGCCA
laccase-4-F	GGTTATCCGCCCTGAATC	PREDICTED: laccase-4
laccase-4-R	AACGGCACGAGGCTCTAT
Chitinase-F	GGATGGGCTGAAGGTTGA	Putative chitinase
Chitinase-R	CAGGTCGAGGTAATACTGGTAA
T-phylloplanin-F	CATTTGCGATGCTACTGA	Similar to T-phylloplanin
T-phylloplanin-R	GCTACGGTGAACTTGGAC
TPA-F	ATCTACAACGAGACGAGCAT	TPA: class III peroxidase 136 precursor
TPA-R	CGAAGTCGCTGAAGAACC
Cla47-F	TTGGGCAGAAGAGCGAGAT	Glutathione-S-transferase Cla47
Cla47-R	AGGGAGGATGGACGGGTT

Fig. 1 (Colour online) Comparison of disease response of ‘Brazil’ and ‘Formosana’ banana. (Left) ‘Formosana’ banana; (right): ‘Brazil’ banana.

Fig. 2 (Colour online) Comparison between the ‘Formosana’ and ‘Brazil’ roots infected by Foc TR4. A, Uninoculated ‘Brazil’ plantlet roots. B, ‘Formosana’ roots. C, ‘Brazil’ roots. Scale bar = 20 µm.

Fig. 3 Confirmation of the infection of banana plantlets by Foc TR4 based on a PCR assay. M: DL2000 marker; K+: Foc TR4 genomic DNA; K−: DNA extracted from the roots of sterilized ‘Brazil’ plantlets; Lanes 1–5: DNA extracted from the roots of five infected ‘Brazil’ plantlets; Lanes 6–10: DNA extracted from the roots of five infected ‘Formosana’ plantlets; K1: H₂O.

Table 2. Details regarding the raw and high-quality reads in bananas ‘Formosana’ and ‘Brazil’.

Samples	The total number of sequences (strip)	The number of bases (bp)	The number of high-quality sequences (strip)	The number of high-quality bases (bp)
‘Formosana’	24 007 117*2	4,849,437,634	20 083 619 *2	3 775 720 372
‘Brazil’	21  815 650*2	4,406,761,300	17 773 064*2	3 341 336 032

Note: Each read consisted of 101 bp.

Fig. 4 (Colour online) Gene ontology classifications. The horizontal axis presents the GO term sub-categories, the left vertical axis corresponds to the proportion of genes included in the sub-categories, and the right vertical axis represents the number of genes in the sub-categories.

Fig. 5 (Colour online) Cluster of orthologous group classifications. The horizontal axis presents the functional categories, while the vertical axis corresponds to the number of unigenes in the categories.

Table 3. The most enriched pathways for the differentially expressed genes in banana.

Term	Id	Sample number	Background number	P-Value	Corrected P-Value	Genes
Flavonoid biosynthesis	ko00941	5	67	8.18E-07	3.19E-05	CUFF.21668.1|CUFF.29055.1|CUFF.26496.1|CUFF.4245.1|CUFF.16156.1
Flavone and flavonol biosynthesis	ko00944	3	29	5.76E-05	0.001123	CUFF.4241.1|CUFF.29055.1|CUFF.26496.1
alpha-Linolenic acid metabolism	ko00592	3	63	0.000588	0.007648	CUFF.26760.1|CUFF.26768.1|CUFF.26742.1
Starch and sucrose metabolism	ko00500	4	243	0.003623	0.035325	CUFF.24142.1|CUFF.4717.1|CUFF.5013.1|CUFF.2143.1
Phenylpropanoid biosynthesis	ko00940	3	144	0.006235	0.048633	CUFF.24142.1|CUFF.1865.1|CUFF.2143.1

Note: Data were analysed using a hypergeometric test and false discovery rate correction method (Benjamini & Hochberg 1995).

Table 4. Previous transcriptomics studies involving banana plants infected by Foc TR4.

	Banana variety	Plant growth stage	Pathogen	Sampling dates (after Foc infection)	Enriched pathways of differentially expressed genes
This study	‘Brazil’ banana and tolerant ‘Formosana’ banana	4.5 months	Foc TR4	4.5 months	Flavonoid biosynthesis, flavone and flavonol biosynthesis, alpha-linolenic acid metabolism, starch and sucrose metabolism, and phenylpropanoid biosynthesis
Wang et al. (2012)	‘Brazil’ banana	60 d	Foc TR4	0, 2, 4, and 6 d	Phenylalanine metabolism, Phenylpropanoid biosynthesis, Drug metabolism – cytochrome P450, alpha-linolenic acid metabolism, Amino sugar and nucleotide sugar metabolism
Li et al. (2013)	‘Brazil’ banana	50 d	Foc1 and Foc TR4	3, 27, and 51 h	PR proteins, Synthesis of phytoalexins and phenolpropanoids, Cell wall modification, Ethylene biosynthesis and signalling pathway
Li et al. (2012)	‘Brazil’ banana and resistant ‘Nongke No 1’	Plants with four or five leaves	Foc TR4	48 and 96 h	Perception of PAMPs by PRRs, Plant hormones biosynthesis and signalling, Transcription factors, Cell wall modification, Flavonoid biosynthesis, Programmed cell death, PR proteins
Bai et al. (2013)	‘Brazil’ banana and resistant ‘Yueyoukang 1'	8 weeks (plants with five leaves)	Foc TR4	0.5, 1, 3, 5, and 10 d	PR proteins, Transcription factors, Cell wall modification, Phenylpropanoid biosynthesis, Plant hormone signal transduction

Table 5. Relative expression levels of specific resistance mechanism-related genes according to qRT-PCR in banana.

		log2Fold change (A/B)
Gene ID	Description	qRT-PCR	RNA-Seq
CUFF.12751	Cellulose synthase catalytic subunit 12	4.62702	2.69907
CUFF.16474	Periplasmic beta-glucosidase precursor, putative	4.84333	3.56937
CUFF.1865	PREDICTED: peroxidase N	10.71611	3.63376
CUFF.29797	PREDICTED: laccase-4	5.76765	3.16864
CUFF.7118	Putative chitinase	7.60023	2.79053
CUFF.5976	Similar to T-phylloplanin	7.78922	3.87321
CUFF.8570	TPA: class III peroxidase 136 precursor	4.65535	3.31414
CUFF.13852	Glutathione-S-transferase Cla47	1.24489	3.20794

A: ‘Formosana’; B: ‘Brazil’.

Table 6. Specific resistance mechanism-related genes in banana.

Gene ID	A_FPKM	B_FPKM	log2fold_change	p_value	q_value	Gene description
CUFF.12751	48.4366	7.45885	−2.69907	2.07E-06	0.001876	cellulose synthase catalytic subunit 12 [Zea mays]
CUFF.16474	4.31267	0.363294	−3.56937	6.56E-05	0.024117	Periplasmic beta-glucosidase precursor, putative [Ricinus communis]
CUFF.1865	60.2792	4.8562	−3.63376	8.79E-08	0.000292	PREDICTED: peroxidase N [Vitis vinifera]
CUFF.20440	50.6218	6.64523	−2.92937	3.17E-07	0.000499	cellulose synthase [Betula luminifera]
CUFF.22126	13.7268	1.80391	−2.9278	3.70E-05	0.01672	laccase [Liriodendron tulipifera]
CUFF.25302	26.9838	4.76472	−2.50163	4.73E-05	0.019706	PREDICTED: laccase-4 [Vitis vinifera]
CUFF.29797	38.3655	4.26664	−3.16864	5.20E-07	0.000653	PREDICTED: laccase-4 [Vitis vinifera]
CUFF.4241	8.92429	0.425703	−4.38982	4.15E-05	0.018221	caffeic acid O-methyltransferase [Camellia sinensis]
CUFF.7118	69.1931	10.0007	−2.79053	5.08E-06	0.003759	putative chitinase [Epipremnum aureum]
CUFF.5976	46.4019	3.16654	−3.87321	2.30E-07	0.000429	similar to T-phylloplanin [Nicotiana tabacum]
CUFF.21873	171.312	1846.52	3.43011	5.02E-09	9.79E-05	RecName:Full = Snakin-1; Flags:Precursor snakin-1 [Solanum tuberosum]
CUFF.8570	30.5278	3.06931	−3.31414	3.42E-05	0.015689	TPA:class III peroxidase 136 precursor [Oryza sativa Japonica Group]
CUFF.13852	54.0644	5.85092	−3.20794	4.44E-06	0.003426	glutathione-S-transferase Cla47 [Elaeis guineensis]

A: ‘Formosana’; B: ‘Brazil’.

Table 7. Phytoalexin biosynthesis-related genes in banana.

Gene ID	A_FPKM	B_FPKM	log2fold_change	p_value	q_value	Gene description
CUFF.11375	16.2028	1.58274	−3.35575	6.78E-06	0.004599	Anthranilate N-benzoyltransferase protein, putative [Ricinus communis]
CUFF.24605	46.1247	5.77207	−2.99838	2.10E-05	0.011585	cytochrome P450 family protein [Musa acuminata]
CUFF.26496	31.277	5.34766	−2.54812	5.10E-05	0.020581	flavonoid 3ʹ,5ʹ-hydroxylase [Dendrobium hybrid cultivar]
CUFF.29055	125.182	22.5285	−2.4742	1.21E-05	0.007361	flavonoid 3ʹ,5ʹ-hydroxylase [Gossypium hirsutum]
CUFF.4245	21.3348	0.729475	−4.87021	1.64E-08	9.79E-05	dihydroflavonol 4-reductase [Anthurium andraeanum]
CUFF.16156	104.982	16.8295	−2.64109	3.66E-06	0.002952	type III polyketide synthase 4 [Musa acuminata AAA Group]
CUFF.21668	67.7461	10.6023	−2.67577	5.47E-06	0.003795	type III polyketide synthase 2 [Musa acuminata AAA Group]

A: ‘Formosana’; B: ‘Brazil’.

Table 8. Stress resistance-related genes (non-specific responses to biotic and abiotic stresses) or genes related to environmental interactions in banana.

Gene ID	A_FPKM	B_FPKM	log2fold_change	P_value	q_value	Gene description
CUFF.20873	26.2729	2.6988	−3.28318	3.22E-06	0.002668	PREDICTED:nicotianamine synthase [Vitis vinifera]
CUFF.22946	9.15963	0.068897	−7.05471	1.95E-06	0.001823	cysteine proteinase precursor [Ipomoea batatas]
CUFF.25075	2.75965	0.044068	−5.96862	7.95E-05	0.027267	PREDICTED:aluminum-activated malate transporter 10-like [Brachypodium distachyon]
CUFF.29519	103.116	724.061	2.81184	2.63E-06	0.002313	arachidonic acid-induced DEA1 precursor [Solanum lycopersicum]
CUFF.97	10.4952	156.091	3.89459	1.25E-08	9.79E-05	PREDICTED:36.4 kDa proline-rich protein-like [Brachypodium distachyon]

A: ‘Formosana’; B: ‘Brazil’.

Table 9. Growth- and development-related genes in banana.

Gene ID	A_FPKM	B_FPKM	log2fold_change	P_value	q_value	Gene description
CUFF.10935	127.319	16.9563	−2.90856	4.62E-07	0.000627	putative thiamine biosynthesis protein [Oryza sativa Japonica Group]
CUFF.11605	66.3772	6.12059	−3.43894	1.99E-07	0.000423	Beta-expansin 3 precursor, putative [Ricinus communis]
CUFF.16771	108.372	21.125	−2.35897	2.94E-05	0.014471	Glutamine synthetase nodule isozyme [Vigna aconitifolia]
CUFF.18098	5.58978	0.499731	−3.48357	0.000104	0.03218	PREDICTED: ammonium transporter 3 member 1-like [Brachypodium distachyon]
CUFF.20530	3.21526	0.067103	−5.58242	9.99E-05	0.031406	PREDICTED: probable peptide/nitrate transporter At1g59740-like [Vitis vinifera]
CUFF.20569	14.2535	1.20206	−3.56774	6.57E-05	0.024117	PREDICTED: auxin-induced protein 5NG4 [Vitis vinifera]
CUFF.22363	5.4585	0.165955	−5.03964	9.36E-05	0.030066	PREDICTED: probable peptide/nitrate transporter At1g59740-like [Glycine max]
CUFF.2604	5.28788	0.31447	−4.07169	1.86E-05	0.010492	sugar transporter [Allium sativum]
CUFF.27654	23.7504	1.90324	−3.64142	6.01E-05	0.023312	germin-like protein [Musa acuminata AAA Group]
CUFF.415	14.6651	1.26488	−3.53531	5.25E-07	0.000653	inorganic pyrophosphatase [Nicotiana tabacum]
CUFF.597	14.3098	1.33667	−3.42028	2.31E-05	0.012322	alpha-expansin 3 [Populus tremula x Populus tremuloides]
CUFF.8264	19.4738	3.72506	−2.3862	0.000136	0.039947	Peptide transporter, putative [Ricinus communis]
CUFF.4717	11.5049	1.43439	−3.00375	6.62E-05	0.024117	cell wall invertase [Musa acuminata AAA Group]
CUFF.19956	8.65075	0.484782	−4.15742	5.04E-05	0.020581	PREDICTED: probable carboxylesterase 2-like [Vitis vinifera]
CUFF.29124	5537.25	39 630.5	2.83937	2.26E-05	0.012292	putative senescence-associated protein [Pisum sativum]
CUFF.5013	11.9841	1.12808	−3.40917	5.21E-06	0.003759	glycosyltransferase, CAZy family GT8 [Populus trichocarpa]

A: ‘Formosana’; B: ‘Brazil’.

Wang Z, Zhang J, Jia C, Liu J, Li Y, Yin X, Xu B, Jin Z. 2012. De novo characterization of the banana root transcriptome and analysis of gene expression under Fusarium oxysporum f. sp. cubense tropical race 4 infection. BMC Genomics. 13:650.

 PubMed Web of Science ®Google Scholar

Li C, Shao J, Wang Y, Li W, Guo D, Yan B, Xia Y, Peng M. 2013. Analysis of banana transcriptome and global gene expression profiles in banana roots in response to infection by race 1 and tropical race 4 of Fusarium oxysporum f. sp. cubense. BMC Genomics. 14:851.

 PubMed Web of Science ®Google Scholar

Li C, Deng G, Yang J, Viljoen A, Jin Y, Kuang R, Zuo C, Lv Z, Yang Q, Sheng O, et al. 2012. Transcriptome profiling of resistant and susceptible Cavendish banana roots following inoculation with Fusarium oxysporum f. sp. cubense tropical race 4. BMC Genomics. 13:374.

 PubMed Web of Science ®Google Scholar

Bai TT, Xie WB, Zhou PP, Wu ZL, Xiao WC, Zhou L, Sun J, Ruan XL, Li HP. 2013. Transcriptome and expression profile analysis of highly resistant and susceptible banana roots challenged with Fusarium oxysporum f. sp. cubense tropical race 4. Plos One. 8:e73945.

 PubMed Web of Science ®Google Scholar