Effects of catechol on growth, antioxidant enzyme activities and melanin biosynthesis gene expression of Rhizoctonia solani AG-1 IA

Figures & data

Table 1. Catechol-induced genes in the Rhizoctonia solani AG-1 IA genome.

Gene ID	Gene function	Gene abbreviation	NCBI GI number	Protein ID	References
AG1IA_02899	Protein tyrosine phosphatase	Ptp	443 924 006	ELU43088.1	Meiser et al. (2013)
AG1IA_07740	Chorismate mutase	Cm	443 917 533	ELU38231.1	Weijn et al. (2013)
AG1IA_08303	Peroxidase	Per	443 916 687	ELU37666.1	Weijn et al. (2013)
AG1IA_10006	Phenylalanyl-tRNA synthetase	Ps	443 912 764	ELU35964.1	Weijn et al. (2013)
AG1IA_01905	Phenol hydroxylase	Ph	443 925 149	ELU44059.1	Kasak et al. (1993)
AG1IA_07535	Aromatic-L-amino-acid decarboxylase	Aad	443 917 795	ELU38434.1	Weijn et al. (2013)
AG1IA_06884	Protein tyrosine kinase	Ptk	443 918 693	ELU39093.1	Alam et al. (2017; Meiser et al. (2013)
AG1IA_09391	Tyrosinase	Tyr	443 914 868	ELU36581.1	Alam et al. (2017); Meiser et al. (2013);Wichers et al. (2003)
AG1IA_01681	Glyceraldehyde-3-phosphate dehydrogenase	GPD	443 925 438	ELU44274.1

Note: Protein ID is the number with which the genes can be found in the genome of Rhizoctonia solani AG-1 IA (http://genedenovoweb.ticp.net:81/rsia/index.php?m=index&f=index).

Table 2. Primers used for qRT-PCR amplification of melanin biosynthesis genes in R. solani AG-1 IA.

Gene ID	5ʹ primer	3ʹ primer
AG1IA_02899	CTTTCTCGCTCACCATCCTC	CTTTTCCCTGTCGCTGTTTTC
AG1IA_07740	CCATAATGACCTTCTACACCCG	TCCCATAATTGCCATCGTCC
AG1IA_08303	GTCAATGCGATCCGTCCTAG	CATGGTTTGCTAAGGCGTTG
AG1IA_10006	ATTCGACCCTACTTTGCCG	AATGAACTTGATCTGGTCCGG
AG1IA_01905	CCTGATATCCGAAACCGTACC	TCATCTTGCTCCTGTCCATTC
AG1IA_07535	CCCGATACAACCACTACAGAAG	AGAAAGTACCAGCAAGATCCG
AG1IA_06884	TCTTAAAAGTGCTCCCGCTG	CATAATGTCCCCTGACTGGTG
AG1IA_09391	CTACCGACTATGTGCCTTTACC	ACCACAGCCCGACATAAAC
AG1IA_01681	TACTCCGCAATGCTATCG	TACTCGGTCCCAGTGGT

Fig. 1 (Colour online) The size and colouration of mycelial masses of R. solani AG-1 IA cultured in PDB at different concentrations of catechol.

Fig. 2 The growth rates of R. solani AG-1 IA cultured in PDA at different concentrations of catechol. Bars represent the mean ± standard error of three replicates; data with different letters are significantly different (P < 0.05) using Duncan’s multiple range test.

Fig. 3 The effects of different concentrations of catechol on the activities of catalase (CAT), peroxidase (POD) and superoxide dismutase (SOD) in R. solani AG-1 IA. Bars represent the mean ± standard error of three replicates; data with different letters are significantly different (P < 0.05) using Duncan’s multiple range test.

Fig. 4 The effects of different concentrations of catechol on the activities of glutathione S-transferase (GSH-ST), glutathione peroxidase (GSH-PX) and glutathione reductase (GR) in R. solani AG-1 IA. Bars represent the mean ± standard error of three replicates; data with different letters are significantly different (P < 0.05) using Duncan’s multiple range test.

Fig. 5 The gene expression levels of R. solani AG-1 IA cultured in PDA at different concentrations of catechol. All gene expression levels were assessed using quantitative real-time PCR analysis and normalized to the housekeeping gene GPD. Bars indicate standard error. *P < 0.05 as compared with the control.

Fig. 6 (Colour online) Virulence of Rhizoctonia solani AG-1 IA cultured in different concentrations of catechol on detached rice leaves. (a) Disease grades of R. solani AG-1 IA on rice leaves. Bars represent the mean ± standard error of three replicates; data with different letters are significantly different (P < 0.05) using Duncan’s multiple range test. (b) Disease phenotypes of R. solani AG-1 IA on rice leaves. CK: PDA (no strain); 0, 12.5, 25, 50 and 100 represent the strain cultured on PDA plates containing 0, 12.5, 25, 50 and 100 μg mL⁻¹ catechol, respectively.

Meiser J, Weindl D, Hiller K. 2013. Complexity of dopamine metabolism. Cell Commun Signal. 11:1974.

 Web of Science ®Google Scholar

Weijn A, Bastiaan-Net S, Wichers HJ, Mes JJ. 2013. Melanin biosynthesis pathway in Agaricus bisporus mushrooms. Fungal Genet Biol. 55:42–53.

 PubMed Web of Science ®Google Scholar

Kasak L, Rak RH, Nurk A, Talvik K, Kivisaar M. 1993. Regulation of the catechol 1,2-dioxygenase- and phenol monooxygenase-encoding pheBA operon in Pseudomonas putida PaW85. J Bacteriol. 175:8038–8042.

 PubMed Web of Science ®Google Scholar

Alam MB, Bajpai VK, Lee J, Zhao P, Byeon J, Ra J, Majumder R, Lee JS, Yoon J, Rather IA, et al. 2017. Inhibition of melanogenesis by jineol from Scolopendra subspinipes mutilans via MAP-Kinase mediated MITF downregulation and the proteasomal degradation of tyrosinase. Sci Rep. 7:45858.

 PubMed Web of Science ®Google Scholar

Wichers HJ, Recourt K, Hendriks M, Ebbelaar CEM, Biancone G, Hoeberichts FA, Mooibroek H, Soler-Rivas C. 2003. Cloning, expression and characterisation of two tyrosinase cDNAs from Agaricus bisporus. Appl Microbiol Biotech. 61:336–341.

 PubMed Web of Science ®Google Scholar